Incidental Mutation 'R4821:Ccdc57'
ID370238
Institutional Source Beutler Lab
Gene Symbol Ccdc57
Ensembl Gene ENSMUSG00000048445
Gene Namecoiled-coil domain containing 57
Synonyms4933434G05Rik
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4821 (G1)
Quality Score162
Status Validated
Chromosome11
Chromosomal Location120826529-120932872 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120860399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056781]
Predicted Effect probably null
Transcript: ENSMUST00000056781
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150640
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Ccdc57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccdc57 APN 11 120860469 missense possibly damaging 0.94
IGL01069:Ccdc57 APN 11 120861259 missense probably benign 0.06
IGL02065:Ccdc57 APN 11 120873760 missense possibly damaging 0.85
IGL02143:Ccdc57 APN 11 120861243 nonsense probably null
R0265:Ccdc57 UTSW 11 120921811 missense probably benign 0.00
R1184:Ccdc57 UTSW 11 120873811 splice site probably benign
R1792:Ccdc57 UTSW 11 120897881 missense possibly damaging 0.82
R1834:Ccdc57 UTSW 11 120861219 missense probably benign 0.07
R1852:Ccdc57 UTSW 11 120921673 missense probably damaging 0.98
R1914:Ccdc57 UTSW 11 120903308 splice site probably benign
R2146:Ccdc57 UTSW 11 120885225 splice site probably benign
R2341:Ccdc57 UTSW 11 120860523 missense probably benign 0.00
R3013:Ccdc57 UTSW 11 120861199 missense probably benign 0.01
R4798:Ccdc57 UTSW 11 120881857 missense possibly damaging 0.73
R4869:Ccdc57 UTSW 11 120903518 splice site probably null
R4964:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R4966:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R5204:Ccdc57 UTSW 11 120886062 missense possibly damaging 0.73
R5993:Ccdc57 UTSW 11 120894724 missense possibly damaging 0.85
R6072:Ccdc57 UTSW 11 120902075 missense probably damaging 0.98
R6404:Ccdc57 UTSW 11 120894712 missense probably benign 0.10
R6877:Ccdc57 UTSW 11 120873702 missense probably benign 0.00
R7074:Ccdc57 UTSW 11 120903374 missense possibly damaging 0.94
R7102:Ccdc57 UTSW 11 120921731 nonsense probably null
R7311:Ccdc57 UTSW 11 120873741 missense probably benign
Z1176:Ccdc57 UTSW 11 120860488 missense possibly damaging 0.89
Z1176:Ccdc57 UTSW 11 120861138 missense probably null
Predicted Primers PCR Primer
(F):5'- TACGGCTTCTGATCTGCAGG -3'
(R):5'- GAGACTTGGAAGCCAGTTTATCAG -3'

Sequencing Primer
(F):5'- CTGATCTGCAGGGCTCTGATACAAG -3'
(R):5'- GTTTATCAGAAAGAAAACAGGACCC -3'
Posted On2016-02-04