Mutagenetix > Incidental Mutations

Incidental Mutation 'R4821:Ncapg2'

370245

Institutional Source

Beutler Lab

Gene Symbol

Ncapg2

Ensembl Gene

ENSMUSG00000042029

Gene Name

non-SMC condensin II complex, subunit G2

Synonyms

Luzp5, 5830426I05Rik, mCAP-G2, Mtb

MMRRC Submission

042437-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4821 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116405402-116463731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 116415457 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 190 (H190Q)

Ref Sequence

ENSEMBL: ENSMUSP00000081889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084828] [ENSMUST00000221114] [ENSMUST00000221970] [ENSMUST00000222469]

AlphaFold

Q6DFV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000084828
AA Change: H190Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: H190Q

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
Pfam:Condensin2nSMC	212	361	7.2e-62	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220608

Predicted Effect

probably benign
Transcript: ENSMUST00000221114

Predicted Effect

probably benign
Transcript: ENSMUST00000221970

Predicted Effect

probably benign
Transcript: ENSMUST00000222469

Meta Mutation Damage Score

0.4114

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,235,674	K150R	probably damaging	Het
4930430A15Rik	T	C	2: 111,204,145		probably null	Het
Aak1	T	C	6: 86,850,189	V46A	probably damaging	Het
Abcb9	T	C	5: 124,090,149	T10A	probably benign	Het
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam33	G	A	2: 131,061,195	P43L	probably benign	Het
Adamtsl2	T	A	2: 27,098,592		probably null	Het
Akap13	A	G	7: 75,677,507		probably benign	Het
Art1	T	A	7: 102,107,178	L192Q	probably damaging	Het
Baalc	A	G	15: 38,933,180		probably benign	Het
Baz2a	A	G	10: 128,111,109	E164G	probably damaging	Het
Bcs1l	A	G	1: 74,591,985	I391V	probably benign	Het
Cacna1c	T	C	6: 118,696,425	T497A	probably damaging	Het
Cap2	C	A	13: 46,610,110	T164N	probably damaging	Het
Ccdc173	T	C	2: 69,782,108	E96G	possibly damaging	Het
Ccdc57	A	G	11: 120,860,399		probably null	Het
Ccdc88c	T	C	12: 100,938,079	N1120S	probably benign	Het
Chd7	T	A	4: 8,844,706	V1605D	probably damaging	Het
Col12a1	A	T	9: 79,715,340		probably benign	Het
Commd3	T	C	2: 18,672,528	S22P	probably benign	Het
Cpd	T	C	11: 76,846,237	I244V	probably benign	Het
Cpeb2	C	A	5: 43,233,474		probably benign	Het
Cyp2c65	A	G	19: 39,072,191	D165G	probably damaging	Het
Ddx1	T	C	12: 13,239,147	Y152C	probably damaging	Het
Dennd4a	G	A	9: 64,897,249	C1290Y	possibly damaging	Het
Ebf4	G	A	2: 130,307,045	M232I	probably benign	Het
Farp2	A	G	1: 93,574,470		probably null	Het
Frk	T	C	10: 34,484,237	V78A	probably benign	Het
Gm5799	A	G	14: 43,544,641	D90G	probably damaging	Het
Gpr45	C	G	1: 43,030,453		probably benign	Het
Hfm1	C	T	5: 106,854,740		probably null	Het
Igkv4-57-1	T	A	6: 69,544,403	D105V	probably damaging	Het
Impdh2-ps	A	G	8: 100,031,363		noncoding transcript	Het
Kctd4	G	A	14: 75,962,777	V63I	probably benign	Het
Lcn6	T	A	2: 25,680,810	L137M	probably damaging	Het
Lonrf1	T	C	8: 36,219,972	N737D	probably benign	Het
Mcu	C	T	10: 59,467,689	V109M	probably damaging	Het
Mecom	C	A	3: 29,985,351	K186N	probably damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mybpc1	T	C	10: 88,548,865	D533G	probably damaging	Het
Nae1	A	C	8: 104,519,784	C294G	probably damaging	Het
Nkx2-2	A	T	2: 147,185,843	L59Q	possibly damaging	Het
Nrxn3	C	T	12: 90,204,709	T295I	probably damaging	Het
Obscn	C	T	11: 59,006,826		probably benign	Het
Obscn	A	T	11: 59,040,467	M5781K	probably damaging	Het
Olfr1285	T	C	2: 111,409,225		noncoding transcript	Het
Olfr1427	T	A	19: 12,098,746	M298L	probably benign	Het
Olfr739	A	G	14: 50,424,749	T77A	possibly damaging	Het
Pcdhb6	C	A	18: 37,334,328	P101T	probably damaging	Het
Pot1b	A	G	17: 55,672,885	S324P	possibly damaging	Het
Ppcdc	C	T	9: 57,434,911	V43I	probably benign	Het
Prr13	A	T	15: 102,460,685		probably benign	Het
Rab10os	T	A	12: 3,237,322		noncoding transcript	Het
Rabgap1	T	C	2: 37,532,519	S595P	probably damaging	Het
Rap1gap	T	C	4: 137,712,129	S126P	probably damaging	Het
Rgs6	A	T	12: 83,067,411		probably null	Het
Slc5a6	T	A	5: 31,036,884	K610*	probably null	Het
Sun5	C	T	2: 153,869,466	V27I	probably benign	Het
Tmco5b	T	C	2: 113,289,757	I126T	probably benign	Het
Tmed7	G	A	18: 46,593,413	Q92*	probably null	Het
Trav7d-2	A	G	14: 52,684,428	D98G	probably benign	Het
Trbv16	T	A	6: 41,152,002	L40Q	probably damaging	Het
Ush2a	T	C	1: 188,753,651	V2986A	probably benign	Het
Usp33	T	C	3: 152,358,673	V58A	probably benign	Het
Vmn2r94	T	A	17: 18,257,031	M373L	probably benign	Het
Ywhaq	T	C	12: 21,417,511		probably benign	Het
Zbbx	G	A	3: 75,081,747	H345Y	possibly damaging	Het
Zfp346	G	T	13: 55,113,813		probably benign	Het
Zfp616	C	T	11: 74,084,207	A434V	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Ncapg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Ncapg2	APN	12	116424650	missense	possibly damaging	0.54
IGL01694:Ncapg2	APN	12	116407230	utr 5 prime	probably benign
IGL01724:Ncapg2	APN	12	116426711	missense	probably damaging	1.00
IGL01792:Ncapg2	APN	12	116425818	missense	probably damaging	0.99
IGL02098:Ncapg2	APN	12	116444332	missense	possibly damaging	0.59
IGL02136:Ncapg2	APN	12	116460583	missense	probably benign
IGL02409:Ncapg2	APN	12	116420717	missense	probably damaging	1.00
IGL02580:Ncapg2	APN	12	116420689	missense	probably damaging	1.00
IGL02653:Ncapg2	APN	12	116425906	critical splice donor site	probably null
IGL03073:Ncapg2	APN	12	116452274	missense	probably benign	0.01
IGL03114:Ncapg2	APN	12	116452373	splice site	probably benign
IGL03199:Ncapg2	APN	12	116419236	missense	probably damaging	1.00
IGL03328:Ncapg2	APN	12	116440057	missense	possibly damaging	0.90
P0033:Ncapg2	UTSW	12	116438635	missense	probably benign	0.03
R0008:Ncapg2	UTSW	12	116429835	missense	probably damaging	1.00
R0194:Ncapg2	UTSW	12	116420683	splice site	probably null
R0379:Ncapg2	UTSW	12	116443075	missense	probably damaging	1.00
R0568:Ncapg2	UTSW	12	116423215	missense	probably damaging	1.00
R0771:Ncapg2	UTSW	12	116413159	nonsense	probably null
R1016:Ncapg2	UTSW	12	116438675	missense	probably damaging	1.00
R1507:Ncapg2	UTSW	12	116460566	missense	probably benign	0.00
R1524:Ncapg2	UTSW	12	116434578	splice site	probably benign
R1596:Ncapg2	UTSW	12	116419236	missense	probably damaging	1.00
R1635:Ncapg2	UTSW	12	116434685	frame shift	probably null
R1752:Ncapg2	UTSW	12	116426718	missense	probably damaging	1.00
R2164:Ncapg2	UTSW	12	116450475	splice site	probably null
R2266:Ncapg2	UTSW	12	116429676	missense	probably damaging	1.00
R2366:Ncapg2	UTSW	12	116420729	nonsense	probably null
R2924:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R2925:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R3828:Ncapg2	UTSW	12	116407318	splice site	probably benign
R3829:Ncapg2	UTSW	12	116407318	splice site	probably benign
R4384:Ncapg2	UTSW	12	116439877	critical splice donor site	probably null
R4651:Ncapg2	UTSW	12	116425787	missense	probably damaging	1.00
R4701:Ncapg2	UTSW	12	116440618	missense	probably benign
R4845:Ncapg2	UTSW	12	116440588	missense	probably damaging	0.96
R5135:Ncapg2	UTSW	12	116427786	missense	possibly damaging	0.64
R5294:Ncapg2	UTSW	12	116427794	missense	possibly damaging	0.54
R5334:Ncapg2	UTSW	12	116426637	missense	probably damaging	1.00
R5588:Ncapg2	UTSW	12	116413077	missense	possibly damaging	0.95
R5888:Ncapg2	UTSW	12	116425800	missense	possibly damaging	0.84
R5938:Ncapg2	UTSW	12	116429657	missense	probably damaging	1.00
R5978:Ncapg2	UTSW	12	116424671	missense	possibly damaging	0.68
R6016:Ncapg2	UTSW	12	116426607	missense	probably damaging	1.00
R6026:Ncapg2	UTSW	12	116443021	missense	possibly damaging	0.73
R6155:Ncapg2	UTSW	12	116438011	missense	possibly damaging	0.83
R6509:Ncapg2	UTSW	12	116427756	missense	probably damaging	1.00
R6675:Ncapg2	UTSW	12	116434661	missense	possibly damaging	0.71
R6912:Ncapg2	UTSW	12	116426582	missense	probably benign
R7069:Ncapg2	UTSW	12	116424717	splice site	probably null
R7339:Ncapg2	UTSW	12	116414834	missense	probably damaging	0.96
R7440:Ncapg2	UTSW	12	116450413	missense	possibly damaging	0.89
R7445:Ncapg2	UTSW	12	116419268	missense	possibly damaging	0.50
R7704:Ncapg2	UTSW	12	116419277	missense	probably damaging	1.00
R8061:Ncapg2	UTSW	12	116426577	missense	probably benign
R8132:Ncapg2	UTSW	12	116444347	missense	possibly damaging	0.93
R8166:Ncapg2	UTSW	12	116412416	missense	probably benign	0.00
R8351:Ncapg2	UTSW	12	116440027	missense	possibly damaging	0.80
R8526:Ncapg2	UTSW	12	116440059	missense	probably benign	0.00
R8692:Ncapg2	UTSW	12	116450429	missense	probably damaging	1.00
R8739:Ncapg2	UTSW	12	116415478	missense	possibly damaging	0.75
R8766:Ncapg2	UTSW	12	116426736	missense	probably damaging	1.00
R8929:Ncapg2	UTSW	12	116452363	missense	probably damaging	1.00
R9046:Ncapg2	UTSW	12	116412525	missense	probably benign	0.01
R9187:Ncapg2	UTSW	12	116438667	missense	probably damaging	1.00
R9344:Ncapg2	UTSW	12	116424653	missense	probably damaging	1.00
R9444:Ncapg2	UTSW	12	116407243	missense	probably damaging	1.00
X0020:Ncapg2	UTSW	12	116424707	missense	probably damaging	1.00
Z1177:Ncapg2	UTSW	12	116438605	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGAGCAGGTAGTCAGGGA -3'
(R):5'- AGCCACATGAATTTAAGGAAAGCAT -3'

Sequencing Primer
(F):5'- GCAGGTAGTCAGGGAGTATCC -3'
(R):5'- GGATATGCAGCTGCTTCCAACTG -3'

Posted On

2016-02-04