Incidental Mutation 'R0421:Fam129a'
ID37030
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0421 (G1)
Quality Score207
Status Validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 151709082 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000148810]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086267
Predicted Effect probably benign
Transcript: ENSMUST00000097541
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148810
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4447:Fam129a UTSW 1 151636402 critical splice acceptor site probably null
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R4774:Fam129a UTSW 1 151715694 missense probably damaging 1.00
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5187:Fam129a UTSW 1 151703829 missense possibly damaging 0.50
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
R7126:Fam129a UTSW 1 151714567 nonsense probably null
R7392:Fam129a UTSW 1 151696224 missense probably damaging 1.00
R7571:Fam129a UTSW 1 151718297 missense probably benign 0.01
R7577:Fam129a UTSW 1 151718312 missense probably benign
R8018:Fam129a UTSW 1 151717255 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTTTGTAAAAGAGGTGCATGG -3'
(R):5'- TCAGGGTACACGCTCTCTCAGTAAG -3'

Sequencing Primer
(F):5'- aaagaggtgcatggactagg -3'
(R):5'- ctctctctctctctctctctctc -3'
Posted On2013-05-09