Mutagenetix > Incidental Mutation

Incidental Mutation 'R4802:Rpgrip1l'

370306

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

042424-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91270177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 692 (T692S)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113] [ENSMUST00000209616]

AlphaFold

Q8CG73

Predicted Effect

probably damaging
Transcript: ENSMUST00000047783
AA Change: T692S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: T692S

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136198

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209616
AA Change: T90S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.2025

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

97% (93/96)

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 167 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,983,926		probably null	Het
4932416K20Rik	T	A	8: 104,797,032		noncoding transcript	Het
Aadacl3	A	G	4: 144,456,232	I222T	probably damaging	Het
Abca13	G	T	11: 9,522,341	G4249V	possibly damaging	Het
Abcb10	A	G	8: 123,966,527	V346A	probably benign	Het
Abcc2	A	T	19: 43,819,361	I814F	probably damaging	Het
AF366264	T	A	8: 13,836,970	I374F	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd28	A	C	14: 31,736,830	D335E	probably damaging	Het
Ankrd44	T	C	1: 54,762,316	H284R	probably damaging	Het
Arfgef3	G	T	10: 18,591,906	Q1849K	probably benign	Het
Bach1	T	A	16: 87,722,452	D543E	probably damaging	Het
Bahcc1	G	A	11: 120,282,225	V1558I	probably benign	Het
Bbs5	T	A	2: 69,655,614	W168R	probably damaging	Het
Bcar3	A	T	3: 122,529,594	D766V	probably benign	Het
C1ra	A	G	6: 124,513,768	D40G	probably benign	Het
Cbr4	T	C	8: 61,490,079		probably benign	Het
Ccdc138	G	A	10: 58,573,643	C598Y	probably damaging	Het
Cd200r3	T	A	16: 44,957,825	N197K	possibly damaging	Het
Cenpf	T	A	1: 189,651,220	E2634D	probably damaging	Het
Cisd2	T	C	3: 135,411,141	K63R	probably damaging	Het
Clca3a2	A	T	3: 144,807,351	S478T	possibly damaging	Het
Clptm1l	T	C	13: 73,607,862	M199T	possibly damaging	Het
Cntnap4	T	A	8: 112,773,590	S505T	possibly damaging	Het
Cr2	C	T	1: 195,163,311	G112D	probably damaging	Het
Crb2	T	A	2: 37,793,756	I1090N	probably benign	Het
Csmd3	G	T	15: 47,621,292	P3057Q	probably damaging	Het
Ctso	G	A	3: 81,954,240	V307I	probably damaging	Het
Cyp3a41b	T	A	5: 145,573,651	T138S	probably benign	Het
Dctn3	G	T	4: 41,719,904	Y67*	probably null	Het
Dennd4c	C	A	4: 86,819,884	Y918*	probably null	Het
Dlg5	C	T	14: 24,154,689	G1262D	probably damaging	Het
Dnaaf1	G	A	8: 119,577,361	G46D	probably benign	Het
Dnah6	A	G	6: 73,089,698	V2563A	probably damaging	Het
Dnajc13	A	G	9: 104,175,727	Y1679H	probably benign	Het
Eif2ak3	T	C	6: 70,887,893	Y578H	probably benign	Het
Endod1	C	T	9: 14,357,023	V389M	probably benign	Het
Entpd2	T	G	2: 25,399,764		probably null	Het
Ephb4	T	C	5: 137,365,506	L582P	probably damaging	Het
Eps15	T	C	4: 109,324,217	L316S	possibly damaging	Het
Erbb4	G	T	1: 68,330,246	T412K	probably damaging	Het
Fam117a	T	A	11: 95,364,070	F90I	probably damaging	Het
Fam187b	T	G	7: 30,977,090	V8G	possibly damaging	Het
Fam84b	C	A	15: 60,823,944		probably benign	Het
Far1	T	A	7: 113,539,453	I59N	possibly damaging	Het
Fbxo34	T	A	14: 47,530,869	L562Q	probably damaging	Het
Frem1	T	A	4: 82,916,628		probably benign	Het
Gfra3	G	T	18: 34,720,192	P10Q	probably damaging	Het
Gm10619	T	A	7: 73,810,025		noncoding transcript	Het
Gm11487	C	T	4: 73,401,267	W80*	probably null	Het
Gm19965	T	A	1: 116,821,896	Y436N	probably benign	Het
Gm21818	T	A	13: 120,173,222	S13R	probably benign	Het
Gm28042	T	C	2: 120,042,054		probably benign	Het
Gm4953	A	T	1: 159,168,418		noncoding transcript	Het
Gm5799	A	T	14: 43,544,548	H59L	probably damaging	Het
Gmppb	T	A	9: 108,050,217	V121E	probably benign	Het
Ighv7-4	G	C	12: 114,223,279		probably benign	Het
Ipo4	A	G	14: 55,631,214	S446P	probably damaging	Het
Itpr2	T	C	6: 146,371,331	T855A	probably damaging	Het
Jaml	T	C	9: 45,101,064	I283T	possibly damaging	Het
Klhl32	T	C	4: 24,649,698	Y399C	possibly damaging	Het
Lrriq1	G	A	10: 103,221,318	T207I	probably benign	Het
Lrriq3	A	T	3: 155,187,970	H436L	probably benign	Het
Mad2l1bp	T	C	17: 46,148,263	K114E	possibly damaging	Het
Mamstr	T	C	7: 45,642,418	V64A	possibly damaging	Het
Map4	T	A	9: 110,035,257	S517T	probably benign	Het
Matn1	A	T	4: 130,950,025	I182F	possibly damaging	Het
Mcm3	A	G	1: 20,810,156	I484T	probably damaging	Het
Med13	T	A	11: 86,278,773	I1922F	probably damaging	Het
Metap2	A	G	10: 93,868,895	V137A	probably damaging	Het
Mex3d	A	G	10: 80,386,954	V156A	possibly damaging	Het
Mfsd6	G	A	1: 52,709,596	P37S	probably benign	Het
Mkl1	T	C	15: 81,104,799	E7G	probably benign	Het
Mrgprx1	A	C	7: 48,021,211	S263A	possibly damaging	Het
Msl1	C	T	11: 98,803,969	R505*	probably null	Het
Mta2	T	C	19: 8,945,851	S96P	probably damaging	Het
Mtr	A	T	13: 12,195,251	N986K	probably benign	Het
Mut	A	G	17: 40,937,351	T90A	probably benign	Het
Mutyh	C	T	4: 116,817,029	T259I	probably benign	Het
Myof	T	C	19: 37,945,738	T908A	probably benign	Het
Nav2	A	T	7: 49,545,852	D992V	possibly damaging	Het
Neb	T	C	2: 52,200,703	T1352A	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nudt19	T	C	7: 35,556,139		probably benign	Het
Nudt6	G	A	3: 37,405,354	R161C	probably benign	Het
Olfr1122	T	A	2: 87,388,209	V168E	probably benign	Het
Olfr1173	T	A	2: 88,274,879	M57L	probably damaging	Het
Olfr125	T	C	17: 37,835,349	Y117H	probably damaging	Het
Olfr1276	T	A	2: 111,257,152	F12L	probably damaging	Het
Olfr1411	T	A	1: 92,596,998	C160S	probably benign	Het
Olfr154	T	A	2: 85,664,278	D52V	probably damaging	Het
Olfr23	T	A	11: 73,940,870	I208K	possibly damaging	Het
Olfr319	T	C	11: 58,701,791	V30A	probably benign	Het
Olfr456	A	T	6: 42,486,679	N171K	probably benign	Het
Olfr744	A	G	14: 50,619,022	T267A	probably benign	Het
Olfr959	T	G	9: 39,572,858	M134L	probably benign	Het
Olr1	A	G	6: 129,488,090	F141S	possibly damaging	Het
Oprl1	G	T	2: 181,719,253	M340I	probably benign	Het
Otogl	A	C	10: 107,901,336	C72W	probably damaging	Het
Pcdha11	T	A	18: 37,005,465	I49N	probably damaging	Het
Pcdha4	T	A	18: 36,953,955	L397*	probably null	Het
Pcdhb14	A	G	18: 37,448,278	S146G	probably benign	Het
Pclo	T	A	5: 14,675,815	H1562Q	unknown	Het
Pcsk9	T	C	4: 106,447,569	E434G	probably benign	Het
Phc2	A	G	4: 128,751,598	K833E	probably damaging	Het
Pja2	A	T	17: 64,292,862	S480R	probably damaging	Het
Pkd1	G	A	17: 24,578,096	G2493D	probably damaging	Het
Plk5	G	A	10: 80,359,304	V179M	possibly damaging	Het
Polr1a	G	A	6: 71,976,070	V1541I	probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Ppp1r14a	A	G	7: 29,291,526	D73G	probably damaging	Het
Psd3	C	T	8: 68,121,148	R127H	probably benign	Het
Pten	G	T	19: 32,758,503	G20V	possibly damaging	Het
Ptprf	G	A	4: 118,210,329		probably benign	Het
Rad54l	T	C	4: 116,122,924	D21G	probably null	Het
Rgs14	T	C	13: 55,380,957	Y304H	probably damaging	Het
Rgs9	T	C	11: 109,240,868	K346R	probably damaging	Het
Rnf169	C	G	7: 99,926,446	G314A	probably damaging	Het
Rtf1	T	C	2: 119,675,228	V54A	possibly damaging	Het
Rtn4	T	C	11: 29,708,660	V938A	probably benign	Het
Ryr2	T	A	13: 11,687,932	D2890V	probably damaging	Het
Ryr2	T	C	13: 11,708,227	T2509A	probably damaging	Het
Scel	A	C	14: 103,583,100	T348P	probably benign	Het
Scgb1b2	G	T	7: 31,291,573	L37I	possibly damaging	Het
Sdf4	A	G	4: 156,000,721	H171R	possibly damaging	Het
Sec31a	A	G	5: 100,393,363	V295A	probably damaging	Het
Setx	T	A	2: 29,146,373	S957T	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Six5	A	G	7: 19,096,969	N507S	probably benign	Het
Slc12a7	T	C	13: 73,763,892		probably null	Het
Slc1a7	T	A	4: 107,993,040	V116E	probably damaging	Het
Slc22a1	A	G	17: 12,675,535	L42P	probably damaging	Het
Slc25a31	A	T	3: 40,721,545	I174F	probably damaging	Het
Slc31a2	A	T	4: 62,292,632	M3L	probably damaging	Het
Slco1a4	T	A	6: 141,845,497		probably benign	Het
Smcr8	C	T	11: 60,778,610		probably null	Het
Smg5	G	T	3: 88,355,692	E801*	probably null	Het
Smgc	C	A	15: 91,854,616	H492Q	probably benign	Het
Smyd4	G	T	11: 75,403,184	G694V	probably damaging	Het
Sorcs3	A	G	19: 48,398,744	T223A	possibly damaging	Het
Stab1	G	T	14: 31,141,371	C2119*	probably null	Het
Taar9	A	G	10: 24,108,843	I231T	probably damaging	Het
Tacr2	A	G	10: 62,261,548	Y269C	probably damaging	Het
Taf3	T	G	2: 9,951,123	K744N	possibly damaging	Het
Tarbp1	C	G	8: 126,474,889	E59D	possibly damaging	Het
Tenm4	T	A	7: 96,906,245	V2682E	probably damaging	Het
Tet1	A	C	10: 62,822,663	L1468R	probably damaging	Het
Tgfb2	A	T	1: 186,628,913	Y380*	probably null	Het
Tgm5	T	G	2: 121,052,472	K435Q	probably damaging	Het
Themis	A	G	10: 28,761,511	T204A	probably benign	Het
Tm4sf1	T	C	3: 57,294,679	Y37C	probably damaging	Het
Tnn	T	C	1: 160,145,033	N333S	possibly damaging	Het
Tppp2	A	G	14: 51,919,348	N61D	probably benign	Het
Treml2	A	G	17: 48,309,159	T276A	probably benign	Het
Trit1	T	C	4: 123,016,638	V10A	probably benign	Het
Ttn	T	A	2: 76,964,646		probably benign	Het
Uba1y	T	G	Y: 825,890		probably null	Het
Vcam1	C	G	3: 116,115,935	G581A	probably damaging	Het
Vmn1r16	G	A	6: 57,323,190	T149I	probably benign	Het
Vmn1r209	T	C	13: 22,805,656	D288G	probably damaging	Het
Vmn1r78	T	A	7: 12,152,964	Y167*	probably null	Het
Vmn2r103	T	A	17: 19,795,076	S493T	probably benign	Het
Vmn2r105	T	A	17: 20,227,294	M423L	probably benign	Het
Vps13c	T	C	9: 67,964,282	F3244L	probably damaging	Het
Zfp119b	A	T	17: 55,939,642	D149E	probably damaging	Het
Zfp345	T	C	2: 150,473,308	Y103C	possibly damaging	Het
Zmym6	C	T	4: 127,123,216	T930I	probably benign	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	possibly damaging	0.67
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R1915:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6956:Rpgrip1l	UTSW	8	91286313	splice site	probably null
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
R7064:Rpgrip1l	UTSW	8	91263520	nonsense	probably null
R7145:Rpgrip1l	UTSW	8	91232806	critical splice donor site	probably null
R7243:Rpgrip1l	UTSW	8	91270123	missense	probably benign	0.00
R7673:Rpgrip1l	UTSW	8	91300787	missense	possibly damaging	0.89
R7796:Rpgrip1l	UTSW	8	91270237	missense	probably damaging	1.00
R8684:Rpgrip1l	UTSW	8	91273701	missense	probably benign	0.00
R8769:Rpgrip1l	UTSW	8	91252584	splice site	probably benign
R8955:Rpgrip1l	UTSW	8	91280828	missense	possibly damaging	0.67
R9006:Rpgrip1l	UTSW	8	91280808	missense	probably benign
R9085:Rpgrip1l	UTSW	8	91287675	missense	possibly damaging	0.68
R9188:Rpgrip1l	UTSW	8	91305010	missense	probably damaging	1.00
R9258:Rpgrip1l	UTSW	8	91260986	nonsense	probably null
R9268:Rpgrip1l	UTSW	8	91280727	missense	probably benign
R9366:Rpgrip1l	UTSW	8	91270181	nonsense	probably null
R9547:Rpgrip1l	UTSW	8	91251245	missense	probably benign	0.00
R9565:Rpgrip1l	UTSW	8	91304888	missense	probably benign	0.05
R9582:Rpgrip1l	UTSW	8	91270258	missense	probably benign	0.03
R9604:Rpgrip1l	UTSW	8	91304805	missense	possibly damaging	0.67
R9614:Rpgrip1l	UTSW	8	91260806	missense	possibly damaging	0.79
R9697:Rpgrip1l	UTSW	8	91260763	missense	possibly damaging	0.49
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CCCAAAATGCCCTTAATGTGTG -3'
(R):5'- TCTTCTGAAGTCCTTCGGGC -3'

Sequencing Primer
(F):5'- AATGCCCTTAATGTGTGAGATAAG -3'
(R):5'- GGCATCTGGTGATAAAGAACTTGTC -3'

Posted On

2016-02-04