Incidental Mutation 'R0421:Abi1'
ID37033
Institutional Source Beutler Lab
Gene Symbol Abi1
Ensembl Gene ENSMUSG00000058835
Gene Nameabl-interactor 1
SynonymsE3B1, Ssh3bp1
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22940073-23040241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22960827 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 195 (T195I)
Ref Sequence ENSEMBL: ENSMUSP00000120462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078977] [ENSMUST00000091394] [ENSMUST00000093171] [ENSMUST00000114544] [ENSMUST00000123948] [ENSMUST00000126112] [ENSMUST00000139038] [ENSMUST00000140164] [ENSMUST00000149719] [ENSMUST00000153931] [ENSMUST00000178908]
Predicted Effect probably damaging
Transcript: ENSMUST00000078977
AA Change: T200I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077997
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 364 N/A INTRINSIC
SH3 393 448 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091394
AA Change: T200I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088957
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 4.1e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
SH3 421 476 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093171
AA Change: T200I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090860
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 363 N/A INTRINSIC
SH3 392 447 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114544
AA Change: T195I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110191
Gene: ENSMUSG00000058835
AA Change: T195I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 4.4e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 268 300 N/A INTRINSIC
SH3 329 384 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123948
AA Change: T200I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118491
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 5.1e-39 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126112
AA Change: T195I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117335
Gene: ENSMUSG00000058835
AA Change: T195I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 388 N/A INTRINSIC
SH3 417 472 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139038
AA Change: T200I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116093
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.4e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
low complexity region 307 334 N/A INTRINSIC
SH3 363 418 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140164
AA Change: T195I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120462
Gene: ENSMUSG00000058835
AA Change: T195I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 360 387 N/A INTRINSIC
SH3 416 471 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149719
AA Change: T195I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120621
Gene: ENSMUSG00000058835
AA Change: T195I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 7.8e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 358 N/A INTRINSIC
SH3 387 442 2.38e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153931
AA Change: T200I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120769
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
SH3 334 389 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156344
Predicted Effect probably damaging
Transcript: ENSMUST00000178908
AA Change: T200I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136846
Gene: ENSMUSG00000058835
AA Change: T200I

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.9e-37 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Meta Mutation Damage Score 0.2733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive embryonic lethality prior during organogenesis associated with about abnormal vasculogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Abi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Abi1 APN 2 22941930 missense possibly damaging 0.71
IGL01694:Abi1 APN 2 22960713 missense probably damaging 1.00
IGL01809:Abi1 APN 2 22946717 missense probably benign 0.00
IGL02189:Abi1 APN 2 23040064 start codon destroyed probably null 1.00
IGL03126:Abi1 APN 2 22953467 missense probably benign 0.12
IGL03213:Abi1 APN 2 22941959 missense probably damaging 1.00
IGL03325:Abi1 APN 2 22971228 missense probably damaging 1.00
R0505:Abi1 UTSW 2 22962504 splice site probably benign
R1265:Abi1 UTSW 2 22946722 missense possibly damaging 0.85
R1851:Abi1 UTSW 2 22950264 missense possibly damaging 0.78
R2975:Abi1 UTSW 2 22957087 missense probably damaging 0.99
R3416:Abi1 UTSW 2 23040002 missense probably damaging 1.00
R5000:Abi1 UTSW 2 22950199 missense probably damaging 1.00
R5277:Abi1 UTSW 2 22994648 missense probably damaging 1.00
R5945:Abi1 UTSW 2 23039965 missense probably damaging 1.00
R6785:Abi1 UTSW 2 22953467 missense probably benign 0.12
R7000:Abi1 UTSW 2 22942041 missense probably damaging 1.00
R7249:Abi1 UTSW 2 22957089 missense possibly damaging 0.82
R7565:Abi1 UTSW 2 22946584 missense probably benign 0.00
R8052:Abi1 UTSW 2 22953543 missense probably benign 0.04
X0026:Abi1 UTSW 2 22971154 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCAGATGTTCAGGTAGAAGGCTTA -3'
(R):5'- TTTGTGGAAGGTTCCAGTCAGCAG -3'

Sequencing Primer
(F):5'- AGAAGGCTTACCTATGCGTC -3'
(R):5'- gcaccattactctctgagcc -3'
Posted On2013-05-09