Mutagenetix > Incidental Mutations

Incidental Mutation 'R0421:Scn9a'

37036

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

038623-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0421 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66543277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 453 (S453G)

Ref Sequence

ENSEMBL: ENSMUSP00000131711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably benign
Transcript: ENSMUST00000100063

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100064
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: S453G

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112354
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: S453G

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151234

Predicted Effect

probably benign
Transcript: ENSMUST00000164384
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: S453G

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169900
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: S453G

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Meta Mutation Damage Score

0.0581

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	T	C	3: 92,868,984	T131A	probably damaging	Het
Abi1	G	A	2: 22,960,827	T195I	probably damaging	Het
Afap1l1	T	C	18: 61,751,874	N180S	probably damaging	Het
Arsg	A	G	11: 109,527,766	Y196C	probably damaging	Het
Ascc3	G	T	10: 50,748,926	V1637L	probably benign	Het
Atp2b2	C	A	6: 113,813,888	R185L	probably damaging	Het
Ccr9	A	T	9: 123,779,606	M118L	probably benign	Het
Cdh12	A	T	15: 21,480,224		probably null	Het
Cdk13	T	C	13: 17,763,170	S763G	probably damaging	Het
Cenpk	C	A	13: 104,242,403	N177K	probably benign	Het
Cfap43	T	G	19: 47,835,575	N119T	probably benign	Het
Chrna6	T	C	8: 27,408,387	E101G	probably null	Het
Clasp2	G	A	9: 113,854,302	R400H	probably benign	Het
Col6a6	T	C	9: 105,784,206	M235V	probably benign	Het
Ddx49	A	T	8: 70,295,632	L291Q	probably damaging	Het
Dhrs7	A	T	12: 72,653,086		probably benign	Het
Dnah5	A	T	15: 28,229,541	K107M	possibly damaging	Het
Dsg2	C	T	18: 20,579,391	R151C	probably damaging	Het
Dsn1	T	C	2: 157,005,869	T2A	possibly damaging	Het
Edem3	A	G	1: 151,792,438		probably benign	Het
Eif3c	T	C	7: 126,563,712	N133S	possibly damaging	Het
F10	A	G	8: 13,045,097	K85E	probably benign	Het
Fam129a	T	A	1: 151,709,082		probably benign	Het
Fam57b	G	A	7: 126,825,015	V44M	probably damaging	Het
Fbn2	T	A	18: 58,027,804		probably benign	Het
Gtpbp10	A	T	5: 5,557,290	H50Q	probably benign	Het
Hephl1	A	G	9: 15,059,160	F1013L	probably benign	Het
Hps3	C	A	3: 20,029,316	V238F	probably benign	Het
Kcna10	A	C	3: 107,194,504	K150N	probably damaging	Het
Kirrel	C	T	3: 87,083,607	G636D	probably damaging	Het
Kndc1	G	A	7: 139,908,996	R189H	probably damaging	Het
Knop1	C	T	7: 118,855,629	E50K	possibly damaging	Het
Kpna7	T	A	5: 144,989,741	H467L	possibly damaging	Het
Lcn4	T	C	2: 26,668,649	N142D	possibly damaging	Het
Map3k3	T	C	11: 106,148,915		probably benign	Het
Mdn1	A	G	4: 32,684,707	T806A	probably benign	Het
Nbeal1	T	A	1: 60,268,439	N1703K	probably benign	Het
Neurl4	T	C	11: 69,908,534	V914A	probably damaging	Het
Nop56	T	C	2: 130,276,772	S275P	possibly damaging	Het
Olfr352	A	G	2: 36,869,641	E25G	possibly damaging	Het
Olfr655	A	G	7: 104,596,722	V153A	probably benign	Het
Olfr868	A	G	9: 20,101,475	K239E	probably damaging	Het
Otof	A	C	5: 30,371,568	I1827S	possibly damaging	Het
Pappa2	A	T	1: 158,848,080	I1032N	probably damaging	Het
Pcdh7	A	G	5: 57,720,060	E319G	probably damaging	Het
Pcdhb11	T	A	18: 37,422,480	S288T	probably benign	Het
Phip	A	T	9: 82,926,457	D488E	probably damaging	Het
Pla2g7	A	T	17: 43,611,412	H394L	probably damaging	Het
Plk3	A	G	4: 117,133,444	V69A	probably damaging	Het
Prob1	C	A	18: 35,653,030	A724S	possibly damaging	Het
Prune2	T	C	19: 17,123,311	F2060L	probably benign	Het
Rgl3	G	A	9: 21,976,032	R498C	probably benign	Het
Rnf213	A	C	11: 119,447,257	N3362H	probably damaging	Het
Sbds	A	G	5: 130,253,933		probably benign	Het
Sh3rf3	T	C	10: 58,984,075	L236P	probably damaging	Het
Skint1	A	G	4: 112,019,014	N44S	possibly damaging	Het
Slc5a1	T	A	5: 33,134,652	I141N	probably damaging	Het
Trank1	T	A	9: 111,391,839	I2548N	probably damaging	Het
Tsc22d2	G	A	3: 58,417,328		probably benign	Het
Unc13c	T	A	9: 73,933,210	I120F	possibly damaging	Het
Vmn2r11	T	G	5: 109,059,428	I9L	probably benign	Het
Vmn2r58	T	G	7: 41,865,204	N114H	probably benign	Het
Vps53	A	G	11: 76,082,670	L166P	probably damaging	Het
Zfp119a	T	A	17: 55,865,248	K532*	probably null	Het
Zfp472	A	G	17: 32,975,923	T11A	possibly damaging	Het
Zfp512b	T	A	2: 181,588,258	K87*	probably null	Het
Zfp518b	G	A	5: 38,674,575	P29L	probably damaging	Het
Zfp599	A	G	9: 22,250,547		probably benign	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TCTGACCCTGACTTGGACAGCTTC -3'
(R):5'- ACAGGTTGCGCTGAGTTGCTTAC -3'

Sequencing Primer
(F):5'- GACTTGGACAGCTTCTCATCATC -3'
(R):5'- CGCTGAGTTGCTTACCTAATATG -3'

Posted On

2013-05-09