Incidental Mutation 'R4801:Setx'
ID 370361
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Name senataxin
Synonyms Als4, A930037J23Rik
MMRRC Submission 042423-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4801 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 29014193-29072483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29036385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 957 (S957T)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
AlphaFold A2AKX3
Predicted Effect probably benign
Transcript: ENSMUST00000061578
AA Change: S957T

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: S957T

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,859,922 (GRCm39) probably null Het
Aadacl3 A G 4: 144,182,802 (GRCm39) I222T probably damaging Het
Abca13 G T 11: 9,472,341 (GRCm39) G4249V possibly damaging Het
Abcb10 A G 8: 124,693,266 (GRCm39) V346A probably benign Het
Abcc2 A T 19: 43,807,800 (GRCm39) I814F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd28 A C 14: 31,458,787 (GRCm39) D335E probably damaging Het
Ankrd44 T C 1: 54,801,475 (GRCm39) H284R probably damaging Het
Arfgef3 G T 10: 18,467,654 (GRCm39) Q1849K probably benign Het
Atp2c2 T C 8: 120,474,426 (GRCm39) M490T probably damaging Het
Bach1 T A 16: 87,519,340 (GRCm39) D543E probably damaging Het
Bahcc1 G A 11: 120,173,051 (GRCm39) V1558I probably benign Het
Bbs5 T A 2: 69,485,958 (GRCm39) W168R probably damaging Het
Bcar3 A T 3: 122,323,243 (GRCm39) D766V probably benign Het
C1ra A G 6: 124,490,727 (GRCm39) D40G probably benign Het
Ccdc138 G A 10: 58,409,465 (GRCm39) C598Y probably damaging Het
Cd200r3 T A 16: 44,778,188 (GRCm39) N197K possibly damaging Het
Cenpf T A 1: 189,383,417 (GRCm39) E2634D probably damaging Het
Cisd2 T C 3: 135,116,902 (GRCm39) K63R probably damaging Het
Clca3a2 A T 3: 144,513,112 (GRCm39) S478T possibly damaging Het
Clptm1l T C 13: 73,755,981 (GRCm39) M199T possibly damaging Het
Cntnap4 T A 8: 113,500,222 (GRCm39) S505T possibly damaging Het
Cr2 C T 1: 194,845,619 (GRCm39) G112D probably damaging Het
Crb2 T A 2: 37,683,768 (GRCm39) I1090N probably benign Het
Csmd3 G T 15: 47,484,688 (GRCm39) P3057Q probably damaging Het
Ctso G A 3: 81,861,547 (GRCm39) V307I probably damaging Het
Cyp3a41b T A 5: 145,510,461 (GRCm39) T138S probably benign Het
Dctn3 G T 4: 41,719,904 (GRCm39) Y67* probably null Het
Dennd4c C A 4: 86,738,121 (GRCm39) Y918* probably null Het
Dlg5 C T 14: 24,204,757 (GRCm39) G1262D probably damaging Het
Dnaaf1 G A 8: 120,304,100 (GRCm39) G46D probably benign Het
Dnah6 A G 6: 73,066,681 (GRCm39) V2563A probably damaging Het
Dnajc13 A G 9: 104,052,926 (GRCm39) Y1679H probably benign Het
Eif2ak3 T C 6: 70,864,877 (GRCm39) Y578H probably benign Het
Endod1 C T 9: 14,268,319 (GRCm39) V389M probably benign Het
Ephb4 T C 5: 137,363,768 (GRCm39) L582P probably damaging Het
Eps15 T C 4: 109,181,414 (GRCm39) L316S possibly damaging Het
Erbb4 G T 1: 68,369,405 (GRCm39) T412K probably damaging Het
Fam117a T A 11: 95,254,896 (GRCm39) F90I probably damaging Het
Fam187b T G 7: 30,676,515 (GRCm39) V8G possibly damaging Het
Far1 T A 7: 113,138,660 (GRCm39) I59N possibly damaging Het
Fbxo34 T A 14: 47,768,326 (GRCm39) L562Q probably damaging Het
Frem1 T A 4: 82,834,865 (GRCm39) probably benign Het
Gfra3 G T 18: 34,853,245 (GRCm39) P10Q probably damaging Het
Gm19965 T A 1: 116,749,626 (GRCm39) Y436N probably benign Het
Gm5799 A T 14: 43,782,005 (GRCm39) H59L probably damaging Het
Gmppb T A 9: 107,927,416 (GRCm39) V121E probably benign Het
Ighv7-4 G C 12: 114,186,899 (GRCm39) probably benign Het
Ipo4 A G 14: 55,868,671 (GRCm39) S446P probably damaging Het
Itpr2 T C 6: 146,272,829 (GRCm39) T855A probably damaging Het
Jaml T C 9: 45,012,362 (GRCm39) I283T possibly damaging Het
Kcnn2 T C 18: 45,818,334 (GRCm39) probably benign Het
Klhl32 T C 4: 24,649,698 (GRCm39) Y399C possibly damaging Het
Litafd A G 16: 8,501,209 (GRCm39) T22A unknown Het
Lratd2 C A 15: 60,695,793 (GRCm39) probably benign Het
Lrriq1 G A 10: 103,057,179 (GRCm39) T207I probably benign Het
Lrriq3 A T 3: 154,893,607 (GRCm39) H436L probably benign Het
Mad2l1bp T C 17: 46,459,189 (GRCm39) K114E possibly damaging Het
Mamstr T C 7: 45,291,842 (GRCm39) V64A possibly damaging Het
Map4 T A 9: 109,864,325 (GRCm39) S517T probably benign Het
Matn1 A T 4: 130,677,336 (GRCm39) I182F possibly damaging Het
Mcm3 A G 1: 20,880,380 (GRCm39) I484T probably damaging Het
Med13 T A 11: 86,169,599 (GRCm39) I1922F probably damaging Het
Metap2 A G 10: 93,704,757 (GRCm39) V137A probably damaging Het
Mex3d A G 10: 80,222,788 (GRCm39) V156A possibly damaging Het
Mfsd6 G A 1: 52,748,755 (GRCm39) P37S probably benign Het
Mmut A G 17: 41,248,242 (GRCm39) T90A probably benign Het
Mrgprx1 A C 7: 47,670,959 (GRCm39) S263A possibly damaging Het
Mrtfa T C 15: 80,989,000 (GRCm39) E7G probably benign Het
Msantd5f6 C T 4: 73,319,504 (GRCm39) W80* probably null Het
Msl1 C T 11: 98,694,795 (GRCm39) R505* probably null Het
Mta2 T C 19: 8,923,215 (GRCm39) S96P probably damaging Het
Mtr A T 13: 12,210,137 (GRCm39) N986K probably benign Het
Mutyh C T 4: 116,674,226 (GRCm39) T259I probably benign Het
Myof T C 19: 37,934,186 (GRCm39) T908A probably benign Het
Nav2 A T 7: 49,195,600 (GRCm39) D992V possibly damaging Het
Neb T C 2: 52,090,715 (GRCm39) T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nudt6 G A 3: 37,459,503 (GRCm39) R161C probably benign Het
Olr1 A G 6: 129,465,053 (GRCm39) F141S possibly damaging Het
Oprl1 G T 2: 181,361,046 (GRCm39) M340I probably benign Het
Or10ag57 T A 2: 87,218,553 (GRCm39) V168E probably benign Het
Or10d1 T G 9: 39,484,154 (GRCm39) M134L probably benign Het
Or11g2 A G 14: 50,856,479 (GRCm39) T267A probably benign Het
Or14j1 T C 17: 38,146,240 (GRCm39) Y117H probably damaging Het
Or1e17 T A 11: 73,831,696 (GRCm39) I208K possibly damaging Het
Or2ak6 T C 11: 58,592,617 (GRCm39) V30A probably benign Het
Or2r2 A T 6: 42,463,613 (GRCm39) N171K probably benign Het
Or4f53 T A 2: 111,087,497 (GRCm39) F12L probably damaging Het
Or5d43 T A 2: 88,105,223 (GRCm39) M57L probably damaging Het
Or5g26 T A 2: 85,494,622 (GRCm39) D52V probably damaging Het
Or9s15 T A 1: 92,524,720 (GRCm39) C160S probably benign Het
Otogl A C 10: 107,737,197 (GRCm39) C72W probably damaging Het
Pcdha11 T A 18: 37,138,518 (GRCm39) I49N probably damaging Het
Pcdha4 T A 18: 37,087,008 (GRCm39) L397* probably null Het
Pcdhb14 A G 18: 37,581,331 (GRCm39) S146G probably benign Het
Pclo T A 5: 14,725,829 (GRCm39) H1562Q unknown Het
Pcsk9 T C 4: 106,304,766 (GRCm39) E434G probably benign Het
Phc2 A G 4: 128,645,391 (GRCm39) K833E probably damaging Het
Pja2 A T 17: 64,599,857 (GRCm39) S480R probably damaging Het
Pkd1 G A 17: 24,797,070 (GRCm39) G2493D probably damaging Het
Plk5 G A 10: 80,195,138 (GRCm39) V179M possibly damaging Het
Polr1a G A 6: 71,953,054 (GRCm39) V1541I probably benign Het
Ppard C G 17: 28,505,348 (GRCm39) R12G unknown Het
Ppp1r14a A G 7: 28,990,951 (GRCm39) D73G probably damaging Het
Psd3 C T 8: 68,573,800 (GRCm39) R127H probably benign Het
Pten G T 19: 32,735,903 (GRCm39) G20V possibly damaging Het
Ptprg T C 14: 11,554,233 (GRCm38) probably benign Het
Rad54l T C 4: 115,980,121 (GRCm39) D21G probably null Het
Rgs14 T C 13: 55,528,770 (GRCm39) Y304H probably damaging Het
Rgs9 T C 11: 109,131,694 (GRCm39) K346R probably damaging Het
Rnf169 C G 7: 99,575,653 (GRCm39) G314A probably damaging Het
Rpgrip1l T A 8: 91,996,805 (GRCm39) T692S probably damaging Het
Rtf1 T C 2: 119,505,709 (GRCm39) V54A possibly damaging Het
Rtn4 T C 11: 29,658,660 (GRCm39) V938A probably benign Het
Ryr2 T A 13: 11,702,818 (GRCm39) D2890V probably damaging Het
Ryr2 T C 13: 11,723,113 (GRCm39) T2509A probably damaging Het
Scel A C 14: 103,820,536 (GRCm39) T348P probably benign Het
Scgb1b2 G T 7: 30,990,998 (GRCm39) L37I possibly damaging Het
Sdf4 A G 4: 156,085,178 (GRCm39) H171R possibly damaging Het
Sec31a A G 5: 100,541,222 (GRCm39) V295A probably damaging Het
Semp2l2a T A 8: 13,886,970 (GRCm39) I374F possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Six5 A G 7: 18,830,894 (GRCm39) N507S probably benign Het
Slc12a7 T C 13: 73,912,011 (GRCm39) probably null Het
Slc1a7 T A 4: 107,850,237 (GRCm39) V116E probably damaging Het
Slc22a1 A G 17: 12,894,422 (GRCm39) L42P probably damaging Het
Slc25a31 A T 3: 40,675,975 (GRCm39) I174F probably damaging Het
Slc31a2 A T 4: 62,210,869 (GRCm39) M3L probably damaging Het
Slco1a4 T A 6: 141,791,223 (GRCm39) probably benign Het
Smcr8 C T 11: 60,669,436 (GRCm39) probably null Het
Smg5 G T 3: 88,262,999 (GRCm39) E801* probably null Het
Smgc C A 15: 91,738,819 (GRCm39) H492Q probably benign Het
Smyd4 G T 11: 75,294,010 (GRCm39) G694V probably damaging Het
Sorcs3 A G 19: 48,387,183 (GRCm39) T223A possibly damaging Het
Stab1 G T 14: 30,863,328 (GRCm39) C2119* probably null Het
Taar9 A G 10: 23,984,741 (GRCm39) I231T probably damaging Het
Tacr2 A G 10: 62,097,327 (GRCm39) Y269C probably damaging Het
Taf3 T G 2: 9,955,934 (GRCm39) K744N possibly damaging Het
Tcstv1b T A 13: 120,634,758 (GRCm39) S13R probably benign Het
Tenm4 T A 7: 96,555,452 (GRCm39) V2682E probably damaging Het
Tet1 A C 10: 62,658,442 (GRCm39) L1468R probably damaging Het
Tgds T C 14: 118,354,445 (GRCm39) probably benign Het
Tgfb2 A T 1: 186,361,110 (GRCm39) Y380* probably null Het
Tgm5 T G 2: 120,882,953 (GRCm39) K435Q probably damaging Het
Themis A G 10: 28,637,507 (GRCm39) T204A probably benign Het
Tm4sf1 T C 3: 57,202,100 (GRCm39) Y37C probably damaging Het
Tmed2b A G 9: 33,640,068 (GRCm39) noncoding transcript Het
Tnn T C 1: 159,972,603 (GRCm39) N333S possibly damaging Het
Tppp2 A G 14: 52,156,805 (GRCm39) N61D probably benign Het
Treml2 A G 17: 48,616,187 (GRCm39) T276A probably benign Het
Trit1 T C 4: 122,910,431 (GRCm39) V10A probably benign Het
Uba1y T G Y: 825,890 (GRCm39) probably null Het
Uqcc1 T C 2: 155,700,026 (GRCm39) probably benign Het
Vcam1 C G 3: 115,909,584 (GRCm39) G581A probably damaging Het
Vmn1r16 G A 6: 57,300,175 (GRCm39) T149I probably benign Het
Vmn1r209 T C 13: 22,989,826 (GRCm39) D288G probably damaging Het
Vmn1r78 T A 7: 11,886,891 (GRCm39) Y167* probably null Het
Vmn2r103 T A 17: 20,015,338 (GRCm39) S493T probably benign Het
Vmn2r105 T A 17: 20,447,556 (GRCm39) M423L probably benign Het
Vps13c T C 9: 67,871,564 (GRCm39) F3244L probably damaging Het
Zfp119b A T 17: 56,246,642 (GRCm39) D149E probably damaging Het
Zfp345 T C 2: 150,315,228 (GRCm39) Y103C possibly damaging Het
Zmym6 C T 4: 127,017,009 (GRCm39) T930I probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29,038,457 (GRCm39) missense possibly damaging 0.50
IGL00806:Setx APN 2 29,017,038 (GRCm39) missense probably damaging 1.00
IGL01346:Setx APN 2 29,034,821 (GRCm39) missense probably damaging 1.00
IGL01623:Setx APN 2 29,053,021 (GRCm39) missense possibly damaging 0.70
IGL02351:Setx APN 2 29,036,976 (GRCm39) missense probably benign 0.45
IGL02358:Setx APN 2 29,036,976 (GRCm39) missense probably benign 0.45
IGL02378:Setx APN 2 29,063,738 (GRCm39) splice site probably benign
IGL02388:Setx APN 2 29,063,665 (GRCm39) missense probably damaging 1.00
IGL02408:Setx APN 2 29,023,942 (GRCm39) missense probably damaging 1.00
IGL02425:Setx APN 2 29,038,420 (GRCm39) missense probably benign 0.00
IGL03023:Setx APN 2 29,035,914 (GRCm39) missense probably benign 0.02
IGL03351:Setx APN 2 29,051,811 (GRCm39) missense probably benign 0.25
Addison UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
dallas UTSW 2 29,044,073 (GRCm39) frame shift probably null
Denton UTSW 2 29,035,072 (GRCm39) missense possibly damaging 0.81
doggie UTSW 2 29,054,562 (GRCm39) missense probably damaging 1.00
Irving UTSW 2 29,029,233 (GRCm39) missense probably damaging 0.99
G1Funyon:Setx UTSW 2 29,035,702 (GRCm39) missense possibly damaging 0.69
IGL03014:Setx UTSW 2 29,029,423 (GRCm39) missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29,023,967 (GRCm39) missense probably damaging 1.00
R0027:Setx UTSW 2 29,029,233 (GRCm39) missense probably damaging 0.99
R0031:Setx UTSW 2 29,066,941 (GRCm39) missense probably benign 0.02
R0070:Setx UTSW 2 29,051,537 (GRCm39) missense probably benign 0.00
R0070:Setx UTSW 2 29,051,537 (GRCm39) missense probably benign 0.00
R0092:Setx UTSW 2 29,036,305 (GRCm39) missense probably benign 0.00
R0193:Setx UTSW 2 29,069,685 (GRCm39) missense probably benign 0.21
R0281:Setx UTSW 2 29,069,655 (GRCm39) missense probably benign 0.00
R0401:Setx UTSW 2 29,056,301 (GRCm39) nonsense probably null
R0413:Setx UTSW 2 29,029,290 (GRCm39) missense probably damaging 1.00
R0517:Setx UTSW 2 29,047,145 (GRCm39) missense probably benign 0.00
R0536:Setx UTSW 2 29,048,260 (GRCm39) missense possibly damaging 0.46
R0617:Setx UTSW 2 29,036,819 (GRCm39) missense possibly damaging 0.86
R1183:Setx UTSW 2 29,070,104 (GRCm39) missense probably benign
R1331:Setx UTSW 2 29,069,698 (GRCm39) missense probably benign
R1465:Setx UTSW 2 29,030,401 (GRCm39) critical splice donor site probably null
R1465:Setx UTSW 2 29,030,401 (GRCm39) critical splice donor site probably null
R1467:Setx UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
R1467:Setx UTSW 2 29,048,917 (GRCm39) missense probably damaging 1.00
R1482:Setx UTSW 2 29,053,004 (GRCm39) missense probably damaging 0.99
R1599:Setx UTSW 2 29,030,385 (GRCm39) missense probably benign 0.04
R1663:Setx UTSW 2 29,016,917 (GRCm39) missense probably damaging 1.00
R1909:Setx UTSW 2 29,053,021 (GRCm39) missense possibly damaging 0.70
R2117:Setx UTSW 2 29,020,313 (GRCm39) missense probably benign 0.01
R2207:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2221:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2223:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2223:Setx UTSW 2 29,038,549 (GRCm39) missense possibly damaging 0.89
R2273:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2274:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2275:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2309:Setx UTSW 2 29,048,916 (GRCm39) missense probably damaging 1.00
R2328:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2328:Setx UTSW 2 29,044,072 (GRCm39) frame shift probably null
R2329:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2331:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2332:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2429:Setx UTSW 2 29,069,910 (GRCm39) missense probably benign 0.00
R2438:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2439:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2496:Setx UTSW 2 29,034,813 (GRCm39) missense probably benign 0.11
R2858:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2859:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2884:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2885:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2886:Setx UTSW 2 29,038,637 (GRCm39) missense probably damaging 0.98
R2915:Setx UTSW 2 29,062,336 (GRCm39) missense probably damaging 0.99
R2921:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R2921:Setx UTSW 2 29,044,072 (GRCm39) small deletion probably benign
R2923:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3426:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3609:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3610:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3731:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3813:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R3835:Setx UTSW 2 29,035,072 (GRCm39) missense possibly damaging 0.81
R3871:Setx UTSW 2 29,035,753 (GRCm39) missense probably damaging 0.98
R4013:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4014:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4015:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4017:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4246:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4248:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4297:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4298:Setx UTSW 2 29,044,073 (GRCm39) frame shift probably null
R4539:Setx UTSW 2 29,069,760 (GRCm39) missense probably benign 0.14
R4590:Setx UTSW 2 29,034,821 (GRCm39) missense probably damaging 1.00
R4632:Setx UTSW 2 29,038,627 (GRCm39) missense probably benign 0.23
R4782:Setx UTSW 2 29,034,058 (GRCm39) missense probably damaging 0.99
R4802:Setx UTSW 2 29,036,385 (GRCm39) missense probably benign 0.14
R4975:Setx UTSW 2 29,054,562 (GRCm39) missense probably damaging 1.00
R5040:Setx UTSW 2 29,029,350 (GRCm39) missense probably damaging 1.00
R5133:Setx UTSW 2 29,070,093 (GRCm39) missense probably benign 0.02
R5208:Setx UTSW 2 29,056,379 (GRCm39) missense possibly damaging 0.63
R5237:Setx UTSW 2 29,036,995 (GRCm39) missense probably benign 0.00
R5248:Setx UTSW 2 29,038,430 (GRCm39) missense probably benign 0.26
R5288:Setx UTSW 2 29,024,045 (GRCm39) critical splice donor site probably null
R5385:Setx UTSW 2 29,024,045 (GRCm39) critical splice donor site probably null
R5387:Setx UTSW 2 29,037,606 (GRCm39) missense probably benign 0.00
R5407:Setx UTSW 2 29,035,486 (GRCm39) missense probably benign 0.00
R5685:Setx UTSW 2 29,061,292 (GRCm39) missense probably damaging 1.00
R6110:Setx UTSW 2 29,030,302 (GRCm39) missense probably damaging 1.00
R6136:Setx UTSW 2 29,038,039 (GRCm39) missense probably benign 0.01
R6310:Setx UTSW 2 29,066,947 (GRCm39) missense possibly damaging 0.57
R6328:Setx UTSW 2 29,064,474 (GRCm39) intron probably benign
R6358:Setx UTSW 2 29,061,360 (GRCm39) missense possibly damaging 0.79
R6384:Setx UTSW 2 29,063,570 (GRCm39) missense probably damaging 1.00
R6400:Setx UTSW 2 29,020,286 (GRCm39) missense probably damaging 0.97
R6572:Setx UTSW 2 29,063,706 (GRCm39) missense possibly damaging 0.63
R6662:Setx UTSW 2 29,048,126 (GRCm39) missense probably damaging 0.97
R6898:Setx UTSW 2 29,038,120 (GRCm39) missense probably benign 0.00
R7188:Setx UTSW 2 29,038,184 (GRCm39) missense probably benign 0.02
R7332:Setx UTSW 2 29,036,638 (GRCm39) missense probably benign 0.00
R7357:Setx UTSW 2 29,020,313 (GRCm39) missense probably benign 0.01
R7556:Setx UTSW 2 29,036,505 (GRCm39) missense possibly damaging 0.88
R7646:Setx UTSW 2 29,067,561 (GRCm39) missense possibly damaging 0.94
R7802:Setx UTSW 2 29,037,033 (GRCm39) missense probably benign 0.02
R7810:Setx UTSW 2 29,038,663 (GRCm39) missense probably benign 0.43
R7831:Setx UTSW 2 29,069,866 (GRCm39) missense possibly damaging 0.75
R7831:Setx UTSW 2 29,047,120 (GRCm39) missense probably damaging 1.00
R7843:Setx UTSW 2 29,063,581 (GRCm39) missense probably damaging 1.00
R7850:Setx UTSW 2 29,037,430 (GRCm39) missense probably damaging 1.00
R7858:Setx UTSW 2 29,051,562 (GRCm39) missense probably damaging 1.00
R8121:Setx UTSW 2 29,035,046 (GRCm39) missense possibly damaging 0.93
R8284:Setx UTSW 2 29,035,348 (GRCm39) missense possibly damaging 0.46
R8301:Setx UTSW 2 29,035,702 (GRCm39) missense possibly damaging 0.69
R8752:Setx UTSW 2 29,048,992 (GRCm39) missense probably damaging 0.97
R8785:Setx UTSW 2 29,035,275 (GRCm39) missense probably damaging 1.00
R8871:Setx UTSW 2 29,038,114 (GRCm39) missense probably benign 0.11
R8927:Setx UTSW 2 29,016,971 (GRCm39) missense possibly damaging 0.59
R8928:Setx UTSW 2 29,016,971 (GRCm39) missense possibly damaging 0.59
R9182:Setx UTSW 2 29,061,299 (GRCm39) missense probably damaging 1.00
R9334:Setx UTSW 2 29,044,032 (GRCm39) nonsense probably null
R9335:Setx UTSW 2 29,035,963 (GRCm39) missense probably benign 0.00
R9491:Setx UTSW 2 29,037,835 (GRCm39) missense probably benign 0.03
R9551:Setx UTSW 2 29,020,244 (GRCm39) missense possibly damaging 0.80
R9627:Setx UTSW 2 29,034,661 (GRCm39) missense probably damaging 1.00
R9688:Setx UTSW 2 29,036,328 (GRCm39) missense probably damaging 1.00
R9689:Setx UTSW 2 29,051,555 (GRCm39) missense probably damaging 1.00
R9747:Setx UTSW 2 29,064,377 (GRCm39) nonsense probably null
R9780:Setx UTSW 2 29,016,999 (GRCm39) missense possibly damaging 0.88
X0066:Setx UTSW 2 29,037,891 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCTCCATGTGAGGGTCATG -3'
(R):5'- GAGCAGTCTTTCCCTATGCATG -3'

Sequencing Primer
(F):5'- CTCCATGTGAGGGTCATGTAAAG -3'
(R):5'- CTATGCATGCTTTACTCTGTTTGATG -3'
Posted On 2016-02-04