Incidental Mutation 'R4801:Gmppb'
ID 370404
Institutional Source Beutler Lab
Gene Symbol Gmppb
Ensembl Gene ENSMUSG00000070284
Gene Name GDP-mannose pyrophosphorylase B
Synonyms
MMRRC Submission 042423-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R4801 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107926490-107929119 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107927416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 121 (V121E)
Ref Sequence ENSEMBL: ENSMUSP00000107914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000160249] [ENSMUST00000177158] [ENSMUST00000178267] [ENSMUST00000176566]
AlphaFold Q8BTZ7
Predicted Effect probably benign
Transcript: ENSMUST00000035214
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047947
AA Change: V121E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284
AA Change: V121E

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085060
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112295
AA Change: V121E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284
AA Change: V121E

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159526
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177396
Predicted Effect probably benign
Transcript: ENSMUST00000177158
SMART Domains Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:IPK 108 206 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176613
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Meta Mutation Damage Score 0.3292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. The encoded protein catalyzes the conversion of mannose-1-phosphate and GTP to GDP-mannose, a reaction involved in the production of N-linked oligosaccharides. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 164 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,859,922 (GRCm39) probably null Het
Aadacl3 A G 4: 144,182,802 (GRCm39) I222T probably damaging Het
Abca13 G T 11: 9,472,341 (GRCm39) G4249V possibly damaging Het
Abcb10 A G 8: 124,693,266 (GRCm39) V346A probably benign Het
Abcc2 A T 19: 43,807,800 (GRCm39) I814F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd28 A C 14: 31,458,787 (GRCm39) D335E probably damaging Het
Ankrd44 T C 1: 54,801,475 (GRCm39) H284R probably damaging Het
Arfgef3 G T 10: 18,467,654 (GRCm39) Q1849K probably benign Het
Atp2c2 T C 8: 120,474,426 (GRCm39) M490T probably damaging Het
Bach1 T A 16: 87,519,340 (GRCm39) D543E probably damaging Het
Bahcc1 G A 11: 120,173,051 (GRCm39) V1558I probably benign Het
Bbs5 T A 2: 69,485,958 (GRCm39) W168R probably damaging Het
Bcar3 A T 3: 122,323,243 (GRCm39) D766V probably benign Het
C1ra A G 6: 124,490,727 (GRCm39) D40G probably benign Het
Ccdc138 G A 10: 58,409,465 (GRCm39) C598Y probably damaging Het
Cd200r3 T A 16: 44,778,188 (GRCm39) N197K possibly damaging Het
Cenpf T A 1: 189,383,417 (GRCm39) E2634D probably damaging Het
Cisd2 T C 3: 135,116,902 (GRCm39) K63R probably damaging Het
Clca3a2 A T 3: 144,513,112 (GRCm39) S478T possibly damaging Het
Clptm1l T C 13: 73,755,981 (GRCm39) M199T possibly damaging Het
Cntnap4 T A 8: 113,500,222 (GRCm39) S505T possibly damaging Het
Cr2 C T 1: 194,845,619 (GRCm39) G112D probably damaging Het
Crb2 T A 2: 37,683,768 (GRCm39) I1090N probably benign Het
Csmd3 G T 15: 47,484,688 (GRCm39) P3057Q probably damaging Het
Ctso G A 3: 81,861,547 (GRCm39) V307I probably damaging Het
Cyp3a41b T A 5: 145,510,461 (GRCm39) T138S probably benign Het
Dctn3 G T 4: 41,719,904 (GRCm39) Y67* probably null Het
Dennd4c C A 4: 86,738,121 (GRCm39) Y918* probably null Het
Dlg5 C T 14: 24,204,757 (GRCm39) G1262D probably damaging Het
Dnaaf1 G A 8: 120,304,100 (GRCm39) G46D probably benign Het
Dnah6 A G 6: 73,066,681 (GRCm39) V2563A probably damaging Het
Dnajc13 A G 9: 104,052,926 (GRCm39) Y1679H probably benign Het
Eif2ak3 T C 6: 70,864,877 (GRCm39) Y578H probably benign Het
Endod1 C T 9: 14,268,319 (GRCm39) V389M probably benign Het
Ephb4 T C 5: 137,363,768 (GRCm39) L582P probably damaging Het
Eps15 T C 4: 109,181,414 (GRCm39) L316S possibly damaging Het
Erbb4 G T 1: 68,369,405 (GRCm39) T412K probably damaging Het
Fam117a T A 11: 95,254,896 (GRCm39) F90I probably damaging Het
Fam187b T G 7: 30,676,515 (GRCm39) V8G possibly damaging Het
Far1 T A 7: 113,138,660 (GRCm39) I59N possibly damaging Het
Fbxo34 T A 14: 47,768,326 (GRCm39) L562Q probably damaging Het
Frem1 T A 4: 82,834,865 (GRCm39) probably benign Het
Gfra3 G T 18: 34,853,245 (GRCm39) P10Q probably damaging Het
Gm19965 T A 1: 116,749,626 (GRCm39) Y436N probably benign Het
Gm5799 A T 14: 43,782,005 (GRCm39) H59L probably damaging Het
Ighv7-4 G C 12: 114,186,899 (GRCm39) probably benign Het
Ipo4 A G 14: 55,868,671 (GRCm39) S446P probably damaging Het
Itpr2 T C 6: 146,272,829 (GRCm39) T855A probably damaging Het
Jaml T C 9: 45,012,362 (GRCm39) I283T possibly damaging Het
Kcnn2 T C 18: 45,818,334 (GRCm39) probably benign Het
Klhl32 T C 4: 24,649,698 (GRCm39) Y399C possibly damaging Het
Litafd A G 16: 8,501,209 (GRCm39) T22A unknown Het
Lratd2 C A 15: 60,695,793 (GRCm39) probably benign Het
Lrriq1 G A 10: 103,057,179 (GRCm39) T207I probably benign Het
Lrriq3 A T 3: 154,893,607 (GRCm39) H436L probably benign Het
Mad2l1bp T C 17: 46,459,189 (GRCm39) K114E possibly damaging Het
Mamstr T C 7: 45,291,842 (GRCm39) V64A possibly damaging Het
Map4 T A 9: 109,864,325 (GRCm39) S517T probably benign Het
Matn1 A T 4: 130,677,336 (GRCm39) I182F possibly damaging Het
Mcm3 A G 1: 20,880,380 (GRCm39) I484T probably damaging Het
Med13 T A 11: 86,169,599 (GRCm39) I1922F probably damaging Het
Metap2 A G 10: 93,704,757 (GRCm39) V137A probably damaging Het
Mex3d A G 10: 80,222,788 (GRCm39) V156A possibly damaging Het
Mfsd6 G A 1: 52,748,755 (GRCm39) P37S probably benign Het
Mmut A G 17: 41,248,242 (GRCm39) T90A probably benign Het
Mrgprx1 A C 7: 47,670,959 (GRCm39) S263A possibly damaging Het
Mrtfa T C 15: 80,989,000 (GRCm39) E7G probably benign Het
Msantd5f6 C T 4: 73,319,504 (GRCm39) W80* probably null Het
Msl1 C T 11: 98,694,795 (GRCm39) R505* probably null Het
Mta2 T C 19: 8,923,215 (GRCm39) S96P probably damaging Het
Mtr A T 13: 12,210,137 (GRCm39) N986K probably benign Het
Mutyh C T 4: 116,674,226 (GRCm39) T259I probably benign Het
Myof T C 19: 37,934,186 (GRCm39) T908A probably benign Het
Nav2 A T 7: 49,195,600 (GRCm39) D992V possibly damaging Het
Neb T C 2: 52,090,715 (GRCm39) T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nudt6 G A 3: 37,459,503 (GRCm39) R161C probably benign Het
Olr1 A G 6: 129,465,053 (GRCm39) F141S possibly damaging Het
Oprl1 G T 2: 181,361,046 (GRCm39) M340I probably benign Het
Or10ag57 T A 2: 87,218,553 (GRCm39) V168E probably benign Het
Or10d1 T G 9: 39,484,154 (GRCm39) M134L probably benign Het
Or11g2 A G 14: 50,856,479 (GRCm39) T267A probably benign Het
Or14j1 T C 17: 38,146,240 (GRCm39) Y117H probably damaging Het
Or1e17 T A 11: 73,831,696 (GRCm39) I208K possibly damaging Het
Or2ak6 T C 11: 58,592,617 (GRCm39) V30A probably benign Het
Or2r2 A T 6: 42,463,613 (GRCm39) N171K probably benign Het
Or4f53 T A 2: 111,087,497 (GRCm39) F12L probably damaging Het
Or5d43 T A 2: 88,105,223 (GRCm39) M57L probably damaging Het
Or5g26 T A 2: 85,494,622 (GRCm39) D52V probably damaging Het
Or9s15 T A 1: 92,524,720 (GRCm39) C160S probably benign Het
Otogl A C 10: 107,737,197 (GRCm39) C72W probably damaging Het
Pcdha11 T A 18: 37,138,518 (GRCm39) I49N probably damaging Het
Pcdha4 T A 18: 37,087,008 (GRCm39) L397* probably null Het
Pcdhb14 A G 18: 37,581,331 (GRCm39) S146G probably benign Het
Pclo T A 5: 14,725,829 (GRCm39) H1562Q unknown Het
Pcsk9 T C 4: 106,304,766 (GRCm39) E434G probably benign Het
Phc2 A G 4: 128,645,391 (GRCm39) K833E probably damaging Het
Pja2 A T 17: 64,599,857 (GRCm39) S480R probably damaging Het
Pkd1 G A 17: 24,797,070 (GRCm39) G2493D probably damaging Het
Plk5 G A 10: 80,195,138 (GRCm39) V179M possibly damaging Het
Polr1a G A 6: 71,953,054 (GRCm39) V1541I probably benign Het
Ppard C G 17: 28,505,348 (GRCm39) R12G unknown Het
Ppp1r14a A G 7: 28,990,951 (GRCm39) D73G probably damaging Het
Psd3 C T 8: 68,573,800 (GRCm39) R127H probably benign Het
Pten G T 19: 32,735,903 (GRCm39) G20V possibly damaging Het
Ptprg T C 14: 11,554,233 (GRCm38) probably benign Het
Rad54l T C 4: 115,980,121 (GRCm39) D21G probably null Het
Rgs14 T C 13: 55,528,770 (GRCm39) Y304H probably damaging Het
Rgs9 T C 11: 109,131,694 (GRCm39) K346R probably damaging Het
Rnf169 C G 7: 99,575,653 (GRCm39) G314A probably damaging Het
Rpgrip1l T A 8: 91,996,805 (GRCm39) T692S probably damaging Het
Rtf1 T C 2: 119,505,709 (GRCm39) V54A possibly damaging Het
Rtn4 T C 11: 29,658,660 (GRCm39) V938A probably benign Het
Ryr2 T A 13: 11,702,818 (GRCm39) D2890V probably damaging Het
Ryr2 T C 13: 11,723,113 (GRCm39) T2509A probably damaging Het
Scel A C 14: 103,820,536 (GRCm39) T348P probably benign Het
Scgb1b2 G T 7: 30,990,998 (GRCm39) L37I possibly damaging Het
Sdf4 A G 4: 156,085,178 (GRCm39) H171R possibly damaging Het
Sec31a A G 5: 100,541,222 (GRCm39) V295A probably damaging Het
Semp2l2a T A 8: 13,886,970 (GRCm39) I374F possibly damaging Het
Setx T A 2: 29,036,385 (GRCm39) S957T probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Six5 A G 7: 18,830,894 (GRCm39) N507S probably benign Het
Slc12a7 T C 13: 73,912,011 (GRCm39) probably null Het
Slc1a7 T A 4: 107,850,237 (GRCm39) V116E probably damaging Het
Slc22a1 A G 17: 12,894,422 (GRCm39) L42P probably damaging Het
Slc25a31 A T 3: 40,675,975 (GRCm39) I174F probably damaging Het
Slc31a2 A T 4: 62,210,869 (GRCm39) M3L probably damaging Het
Slco1a4 T A 6: 141,791,223 (GRCm39) probably benign Het
Smcr8 C T 11: 60,669,436 (GRCm39) probably null Het
Smg5 G T 3: 88,262,999 (GRCm39) E801* probably null Het
Smgc C A 15: 91,738,819 (GRCm39) H492Q probably benign Het
Smyd4 G T 11: 75,294,010 (GRCm39) G694V probably damaging Het
Sorcs3 A G 19: 48,387,183 (GRCm39) T223A possibly damaging Het
Stab1 G T 14: 30,863,328 (GRCm39) C2119* probably null Het
Taar9 A G 10: 23,984,741 (GRCm39) I231T probably damaging Het
Tacr2 A G 10: 62,097,327 (GRCm39) Y269C probably damaging Het
Taf3 T G 2: 9,955,934 (GRCm39) K744N possibly damaging Het
Tcstv1b T A 13: 120,634,758 (GRCm39) S13R probably benign Het
Tenm4 T A 7: 96,555,452 (GRCm39) V2682E probably damaging Het
Tet1 A C 10: 62,658,442 (GRCm39) L1468R probably damaging Het
Tgds T C 14: 118,354,445 (GRCm39) probably benign Het
Tgfb2 A T 1: 186,361,110 (GRCm39) Y380* probably null Het
Tgm5 T G 2: 120,882,953 (GRCm39) K435Q probably damaging Het
Themis A G 10: 28,637,507 (GRCm39) T204A probably benign Het
Tm4sf1 T C 3: 57,202,100 (GRCm39) Y37C probably damaging Het
Tmed2b A G 9: 33,640,068 (GRCm39) noncoding transcript Het
Tnn T C 1: 159,972,603 (GRCm39) N333S possibly damaging Het
Tppp2 A G 14: 52,156,805 (GRCm39) N61D probably benign Het
Treml2 A G 17: 48,616,187 (GRCm39) T276A probably benign Het
Trit1 T C 4: 122,910,431 (GRCm39) V10A probably benign Het
Uba1y T G Y: 825,890 (GRCm39) probably null Het
Uqcc1 T C 2: 155,700,026 (GRCm39) probably benign Het
Vcam1 C G 3: 115,909,584 (GRCm39) G581A probably damaging Het
Vmn1r16 G A 6: 57,300,175 (GRCm39) T149I probably benign Het
Vmn1r209 T C 13: 22,989,826 (GRCm39) D288G probably damaging Het
Vmn1r78 T A 7: 11,886,891 (GRCm39) Y167* probably null Het
Vmn2r103 T A 17: 20,015,338 (GRCm39) S493T probably benign Het
Vmn2r105 T A 17: 20,447,556 (GRCm39) M423L probably benign Het
Vps13c T C 9: 67,871,564 (GRCm39) F3244L probably damaging Het
Zfp119b A T 17: 56,246,642 (GRCm39) D149E probably damaging Het
Zfp345 T C 2: 150,315,228 (GRCm39) Y103C possibly damaging Het
Zmym6 C T 4: 127,017,009 (GRCm39) T930I probably benign Het
Other mutations in Gmppb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Gmppb APN 9 107,928,446 (GRCm39) splice site probably null
IGL02685:Gmppb APN 9 107,927,118 (GRCm39) unclassified probably benign
R0308:Gmppb UTSW 9 107,927,033 (GRCm39) missense probably benign 0.28
R0553:Gmppb UTSW 9 107,926,996 (GRCm39) missense probably benign 0.02
R3804:Gmppb UTSW 9 107,927,773 (GRCm39) missense probably damaging 1.00
R3973:Gmppb UTSW 9 107,927,338 (GRCm39) missense probably benign 0.01
R4802:Gmppb UTSW 9 107,927,416 (GRCm39) missense probably benign 0.02
R5424:Gmppb UTSW 9 107,929,204 (GRCm39) splice site probably null
R7809:Gmppb UTSW 9 107,928,654 (GRCm39) makesense probably null
R7895:Gmppb UTSW 9 107,927,770 (GRCm39) missense probably benign 0.00
R9668:Gmppb UTSW 9 107,928,362 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGAAGAGGAGCCTTTGGG -3'
(R):5'- TGCCTATCCCACATCTCAAAGG -3'

Sequencing Primer
(F):5'- CTTGGGCAAACTTTAGGGCCAG -3'
(R):5'- GCTCTCCCCCAAAGACATTCTG -3'
Posted On 2016-02-04