Mutagenetix > Incidental Mutation

Incidental Mutation 'R4801:Ptprg'

370420

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

042423-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4801 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

utr 5 prime

DNA Base Change (assembly)

T to C at 11554233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000142917]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022264

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148113

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 164 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,983,926		probably null	Het
Aadacl3	A	G	4: 144,456,232	I222T	probably damaging	Het
Abca13	G	T	11: 9,522,341	G4249V	possibly damaging	Het
Abcb10	A	G	8: 123,966,527	V346A	probably benign	Het
Abcc2	A	T	19: 43,819,361	I814F	probably damaging	Het
AF366264	T	A	8: 13,836,970	I374F	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd28	A	C	14: 31,736,830	D335E	probably damaging	Het
Ankrd44	T	C	1: 54,762,316	H284R	probably damaging	Het
Arfgef3	G	T	10: 18,591,906	Q1849K	probably benign	Het
Atp2c2	T	C	8: 119,747,687	M490T	probably damaging	Het
Bach1	T	A	16: 87,722,452	D543E	probably damaging	Het
Bahcc1	G	A	11: 120,282,225	V1558I	probably benign	Het
Bbs5	T	A	2: 69,655,614	W168R	probably damaging	Het
Bcar3	A	T	3: 122,529,594	D766V	probably benign	Het
C1ra	A	G	6: 124,513,768	D40G	probably benign	Het
Ccdc138	G	A	10: 58,573,643	C598Y	probably damaging	Het
Cd200r3	T	A	16: 44,957,825	N197K	possibly damaging	Het
Cenpf	T	A	1: 189,651,220	E2634D	probably damaging	Het
Cisd2	T	C	3: 135,411,141	K63R	probably damaging	Het
Clca3a2	A	T	3: 144,807,351	S478T	possibly damaging	Het
Clptm1l	T	C	13: 73,607,862	M199T	possibly damaging	Het
Cntnap4	T	A	8: 112,773,590	S505T	possibly damaging	Het
Cr2	C	T	1: 195,163,311	G112D	probably damaging	Het
Crb2	T	A	2: 37,793,756	I1090N	probably benign	Het
Csmd3	G	T	15: 47,621,292	P3057Q	probably damaging	Het
Ctso	G	A	3: 81,954,240	V307I	probably damaging	Het
Cyp3a41b	T	A	5: 145,573,651	T138S	probably benign	Het
Dctn3	G	T	4: 41,719,904	Y67*	probably null	Het
Dennd4c	C	A	4: 86,819,884	Y918*	probably null	Het
Dlg5	C	T	14: 24,154,689	G1262D	probably damaging	Het
Dnaaf1	G	A	8: 119,577,361	G46D	probably benign	Het
Dnah6	A	G	6: 73,089,698	V2563A	probably damaging	Het
Dnajc13	A	G	9: 104,175,727	Y1679H	probably benign	Het
Eif2ak3	T	C	6: 70,887,893	Y578H	probably benign	Het
Endod1	C	T	9: 14,357,023	V389M	probably benign	Het
Ephb4	T	C	5: 137,365,506	L582P	probably damaging	Het
Eps15	T	C	4: 109,324,217	L316S	possibly damaging	Het
Erbb4	G	T	1: 68,330,246	T412K	probably damaging	Het
Fam117a	T	A	11: 95,364,070	F90I	probably damaging	Het
Fam187b	T	G	7: 30,977,090	V8G	possibly damaging	Het
Fam84b	C	A	15: 60,823,944		probably benign	Het
Far1	T	A	7: 113,539,453	I59N	possibly damaging	Het
Fbxo34	T	A	14: 47,530,869	L562Q	probably damaging	Het
Frem1	T	A	4: 82,916,628		probably benign	Het
Gfra3	G	T	18: 34,720,192	P10Q	probably damaging	Het
Gm10698	A	G	9: 33,728,772		noncoding transcript	Het
Gm11487	C	T	4: 73,401,267	W80*	probably null	Het
Gm19965	T	A	1: 116,821,896	Y436N	probably benign	Het
Gm21818	T	A	13: 120,173,222	S13R	probably benign	Het
Gm5767	A	G	16: 8,683,345	T22A	unknown	Het
Gm5799	A	T	14: 43,544,548	H59L	probably damaging	Het
Gmppb	T	A	9: 108,050,217	V121E	probably benign	Het
Ighv7-4	G	C	12: 114,223,279		probably benign	Het
Ipo4	A	G	14: 55,631,214	S446P	probably damaging	Het
Itpr2	T	C	6: 146,371,331	T855A	probably damaging	Het
Jaml	T	C	9: 45,101,064	I283T	possibly damaging	Het
Kcnn2	T	C	18: 45,685,267		probably benign	Het
Klhl32	T	C	4: 24,649,698	Y399C	possibly damaging	Het
Lrriq1	G	A	10: 103,221,318	T207I	probably benign	Het
Lrriq3	A	T	3: 155,187,970	H436L	probably benign	Het
Mad2l1bp	T	C	17: 46,148,263	K114E	possibly damaging	Het
Mamstr	T	C	7: 45,642,418	V64A	possibly damaging	Het
Map4	T	A	9: 110,035,257	S517T	probably benign	Het
Matn1	A	T	4: 130,950,025	I182F	possibly damaging	Het
Mcm3	A	G	1: 20,810,156	I484T	probably damaging	Het
Med13	T	A	11: 86,278,773	I1922F	probably damaging	Het
Metap2	A	G	10: 93,868,895	V137A	probably damaging	Het
Mex3d	A	G	10: 80,386,954	V156A	possibly damaging	Het
Mfsd6	G	A	1: 52,709,596	P37S	probably benign	Het
Mkl1	T	C	15: 81,104,799	E7G	probably benign	Het
Mrgprx1	A	C	7: 48,021,211	S263A	possibly damaging	Het
Msl1	C	T	11: 98,803,969	R505*	probably null	Het
Mta2	T	C	19: 8,945,851	S96P	probably damaging	Het
Mtr	A	T	13: 12,195,251	N986K	probably benign	Het
Mut	A	G	17: 40,937,351	T90A	probably benign	Het
Mutyh	C	T	4: 116,817,029	T259I	probably benign	Het
Myof	T	C	19: 37,945,738	T908A	probably benign	Het
Nav2	A	T	7: 49,545,852	D992V	possibly damaging	Het
Neb	T	C	2: 52,200,703	T1352A	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nudt6	G	A	3: 37,405,354	R161C	probably benign	Het
Olfr1122	T	A	2: 87,388,209	V168E	probably benign	Het
Olfr1173	T	A	2: 88,274,879	M57L	probably damaging	Het
Olfr125	T	C	17: 37,835,349	Y117H	probably damaging	Het
Olfr1276	T	A	2: 111,257,152	F12L	probably damaging	Het
Olfr1411	T	A	1: 92,596,998	C160S	probably benign	Het
Olfr154	T	A	2: 85,664,278	D52V	probably damaging	Het
Olfr23	T	A	11: 73,940,870	I208K	possibly damaging	Het
Olfr319	T	C	11: 58,701,791	V30A	probably benign	Het
Olfr456	A	T	6: 42,486,679	N171K	probably benign	Het
Olfr744	A	G	14: 50,619,022	T267A	probably benign	Het
Olfr959	T	G	9: 39,572,858	M134L	probably benign	Het
Olr1	A	G	6: 129,488,090	F141S	possibly damaging	Het
Oprl1	G	T	2: 181,719,253	M340I	probably benign	Het
Otogl	A	C	10: 107,901,336	C72W	probably damaging	Het
Pcdha11	T	A	18: 37,005,465	I49N	probably damaging	Het
Pcdha4	T	A	18: 36,953,955	L397*	probably null	Het
Pcdhb14	A	G	18: 37,448,278	S146G	probably benign	Het
Pclo	T	A	5: 14,675,815	H1562Q	unknown	Het
Pcsk9	T	C	4: 106,447,569	E434G	probably benign	Het
Phc2	A	G	4: 128,751,598	K833E	probably damaging	Het
Pja2	A	T	17: 64,292,862	S480R	probably damaging	Het
Pkd1	G	A	17: 24,578,096	G2493D	probably damaging	Het
Plk5	G	A	10: 80,359,304	V179M	possibly damaging	Het
Polr1a	G	A	6: 71,976,070	V1541I	probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Ppp1r14a	A	G	7: 29,291,526	D73G	probably damaging	Het
Psd3	C	T	8: 68,121,148	R127H	probably benign	Het
Pten	G	T	19: 32,758,503	G20V	possibly damaging	Het
Rad54l	T	C	4: 116,122,924	D21G	probably null	Het
Rgs14	T	C	13: 55,380,957	Y304H	probably damaging	Het
Rgs9	T	C	11: 109,240,868	K346R	probably damaging	Het
Rnf169	C	G	7: 99,926,446	G314A	probably damaging	Het
Rpgrip1l	T	A	8: 91,270,177	T692S	probably damaging	Het
Rtf1	T	C	2: 119,675,228	V54A	possibly damaging	Het
Rtn4	T	C	11: 29,708,660	V938A	probably benign	Het
Ryr2	T	A	13: 11,687,932	D2890V	probably damaging	Het
Ryr2	T	C	13: 11,708,227	T2509A	probably damaging	Het
Scel	A	C	14: 103,583,100	T348P	probably benign	Het
Scgb1b2	G	T	7: 31,291,573	L37I	possibly damaging	Het
Sdf4	A	G	4: 156,000,721	H171R	possibly damaging	Het
Sec31a	A	G	5: 100,393,363	V295A	probably damaging	Het
Setx	T	A	2: 29,146,373	S957T	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Six5	A	G	7: 19,096,969	N507S	probably benign	Het
Slc12a7	T	C	13: 73,763,892		probably null	Het
Slc1a7	T	A	4: 107,993,040	V116E	probably damaging	Het
Slc22a1	A	G	17: 12,675,535	L42P	probably damaging	Het
Slc25a31	A	T	3: 40,721,545	I174F	probably damaging	Het
Slc31a2	A	T	4: 62,292,632	M3L	probably damaging	Het
Slco1a4	T	A	6: 141,845,497		probably benign	Het
Smcr8	C	T	11: 60,778,610		probably null	Het
Smg5	G	T	3: 88,355,692	E801*	probably null	Het
Smgc	C	A	15: 91,854,616	H492Q	probably benign	Het
Smyd4	G	T	11: 75,403,184	G694V	probably damaging	Het
Sorcs3	A	G	19: 48,398,744	T223A	possibly damaging	Het
Stab1	G	T	14: 31,141,371	C2119*	probably null	Het
Taar9	A	G	10: 24,108,843	I231T	probably damaging	Het
Tacr2	A	G	10: 62,261,548	Y269C	probably damaging	Het
Taf3	T	G	2: 9,951,123	K744N	possibly damaging	Het
Tenm4	T	A	7: 96,906,245	V2682E	probably damaging	Het
Tet1	A	C	10: 62,822,663	L1468R	probably damaging	Het
Tgds	T	C	14: 118,117,033		probably benign	Het
Tgfb2	A	T	1: 186,628,913	Y380*	probably null	Het
Tgm5	T	G	2: 121,052,472	K435Q	probably damaging	Het
Themis	A	G	10: 28,761,511	T204A	probably benign	Het
Tm4sf1	T	C	3: 57,294,679	Y37C	probably damaging	Het
Tnn	T	C	1: 160,145,033	N333S	possibly damaging	Het
Tppp2	A	G	14: 51,919,348	N61D	probably benign	Het
Treml2	A	G	17: 48,309,159	T276A	probably benign	Het
Trit1	T	C	4: 123,016,638	V10A	probably benign	Het
Uba1y	T	G	Y: 825,890		probably null	Het
Uqcc1	T	C	2: 155,858,106		probably benign	Het
Vcam1	C	G	3: 116,115,935	G581A	probably damaging	Het
Vmn1r16	G	A	6: 57,323,190	T149I	probably benign	Het
Vmn1r209	T	C	13: 22,805,656	D288G	probably damaging	Het
Vmn1r78	T	A	7: 12,152,964	Y167*	probably null	Het
Vmn2r103	T	A	17: 19,795,076	S493T	probably benign	Het
Vmn2r105	T	A	17: 20,227,294	M423L	probably benign	Het
Vps13c	T	C	9: 67,964,282	F3244L	probably damaging	Het
Zfp119b	A	T	17: 55,939,642	D149E	probably damaging	Het
Zfp345	T	C	2: 150,473,308	Y103C	possibly damaging	Het
Zmym6	C	T	4: 127,123,216	T930I	probably benign	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7088:Ptprg	UTSW	14	12207365	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
R8860:Ptprg	UTSW	14	12213685	missense	probably damaging	1.00
R8992:Ptprg	UTSW	14	12154170	missense	probably benign	0.00
R9054:Ptprg	UTSW	14	12213638	missense	possibly damaging	0.58
R9587:Ptprg	UTSW	14	12215992	missense	probably damaging	1.00
R9621:Ptprg	UTSW	14	12237809	missense	probably benign
R9625:Ptprg	UTSW	14	12152027	missense	probably damaging	1.00
R9773:Ptprg	UTSW	14	12199806	missense	probably damaging	0.97
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTTGGCTTTGCATTCCCG -3'
(R):5'- GAAGCAGAGCTCTCTTTCCTCC -3'

Sequencing Primer
(F):5'- GCATTCCCGGTCACTTTTTGAGG -3'
(R):5'- TAGACTGGCGCCCAAGCTC -3'

Posted On

2016-02-04