Incidental Mutation 'R4803:Olfr1193'
ID370442
Institutional Source Beutler Lab
Gene Symbol Olfr1193
Ensembl Gene ENSMUSG00000060827
Gene Nameolfactory receptor 1193
SynonymsGA_x6K02T2Q125-50154044-50154826, GA_x6K02T2Q125-50158288-50158818, Olfr1194-ps1, MOR226-1, MOR230-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88675628-88681143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88678022 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 56 (S56C)
Ref Sequence ENSEMBL: ENSMUSP00000080399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
Predicted Effect probably benign
Transcript: ENSMUST00000081697
AA Change: S56C

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827
AA Change: S56C

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
Predicted Effect probably benign
Transcript: ENSMUST00000213893
AA Change: S49C

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216767
AA Change: S49C

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217271
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Olfr1193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Olfr1193 APN 2 88678733 missense probably damaging 1.00
R0322:Olfr1193 UTSW 2 88678667 missense probably damaging 0.98
R0711:Olfr1193 UTSW 2 88678674 missense probably damaging 1.00
R1500:Olfr1193 UTSW 2 88677875 missense possibly damaging 0.73
R1610:Olfr1193 UTSW 2 88678574 nonsense probably null
R4380:Olfr1193 UTSW 2 88678271 missense possibly damaging 0.61
R4602:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4602:Olfr1193 UTSW 2 88678179 missense probably benign
R4610:Olfr1193 UTSW 2 88677896 missense probably benign 0.08
R4610:Olfr1193 UTSW 2 88678179 missense probably benign
R4790:Olfr1193 UTSW 2 88678387 missense possibly damaging 0.73
R5402:Olfr1193 UTSW 2 88678148 missense possibly damaging 0.74
R5736:Olfr1193 UTSW 2 88678641 missense probably benign 0.00
R6896:Olfr1193 UTSW 2 88677996 missense probably damaging 1.00
R6998:Olfr1193 UTSW 2 88678508 missense probably benign 0.23
R7038:Olfr1193 UTSW 2 88678741 missense probably damaging 1.00
R8806:Olfr1193 UTSW 2 88678611 missense probably benign 0.01
X0022:Olfr1193 UTSW 2 88678320 missense probably benign 0.08
Z1088:Olfr1193 UTSW 2 88678664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTAACTTCAACCAGTAGCCAC -3'
(R):5'- TCTCAGTGCAACCAAAGAAATG -3'

Sequencing Primer
(F):5'- AACATTCTTTTGAGGATATGGCC -3'
(R):5'- TGAACCACAAAGAGTTGTAACATGC -3'
Posted On2016-02-04