Incidental Mutation 'R4803:Ckap2l'
ID370444
Institutional Source Beutler Lab
Gene Symbol Ckap2l
Ensembl Gene ENSMUSG00000048327
Gene Namecytoskeleton associated protein 2-like
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129268210-129297212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129269256 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 674 (G674R)
Ref Sequence ENSEMBL: ENSMUSP00000056145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052708]
Predicted Effect probably damaging
Transcript: ENSMUST00000052708
AA Change: G674R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: G674R

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141964
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Ckap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ckap2l APN 2 129269216 missense probably damaging 1.00
IGL02120:Ckap2l APN 2 129285622 missense possibly damaging 0.58
IGL03085:Ckap2l APN 2 129285047 missense probably benign 0.00
IGL03175:Ckap2l APN 2 129285517 missense probably benign 0.01
IGL03333:Ckap2l APN 2 129296308 splice site probably null
R0196:Ckap2l UTSW 2 129285422 missense probably benign 0.43
R0501:Ckap2l UTSW 2 129285491 missense possibly damaging 0.78
R0715:Ckap2l UTSW 2 129285716 missense probably benign 0.02
R0834:Ckap2l UTSW 2 129296304 splice site probably benign
R1119:Ckap2l UTSW 2 129272572 splice site probably benign
R1561:Ckap2l UTSW 2 129270725 missense probably benign 0.01
R1677:Ckap2l UTSW 2 129285167 missense possibly damaging 0.86
R1823:Ckap2l UTSW 2 129275579 missense probably damaging 1.00
R1971:Ckap2l UTSW 2 129285422 missense possibly damaging 0.92
R5214:Ckap2l UTSW 2 129285469 missense probably benign 0.02
R5264:Ckap2l UTSW 2 129285379 missense probably benign 0.01
R5297:Ckap2l UTSW 2 129285370 missense possibly damaging 0.56
R5535:Ckap2l UTSW 2 129285842 missense probably benign 0.00
R5606:Ckap2l UTSW 2 129286039 missense probably damaging 0.98
R6327:Ckap2l UTSW 2 129285494 missense probably damaging 1.00
R6489:Ckap2l UTSW 2 129269114 missense possibly damaging 0.85
R6726:Ckap2l UTSW 2 129269194 missense probably damaging 1.00
R7199:Ckap2l UTSW 2 129285055 missense probably benign 0.25
R7220:Ckap2l UTSW 2 129275516 missense probably damaging 1.00
R7329:Ckap2l UTSW 2 129285364 missense possibly damaging 0.56
R7374:Ckap2l UTSW 2 129284963 missense probably damaging 1.00
R7383:Ckap2l UTSW 2 129269252 missense possibly damaging 0.88
R7484:Ckap2l UTSW 2 129272535 missense possibly damaging 0.82
R7611:Ckap2l UTSW 2 129285680 missense possibly damaging 0.88
R7868:Ckap2l UTSW 2 129285289 missense probably damaging 1.00
R8338:Ckap2l UTSW 2 129285019 missense probably damaging 0.99
R8514:Ckap2l UTSW 2 129285868 missense possibly damaging 0.61
R8790:Ckap2l UTSW 2 129269252 missense possibly damaging 0.88
RF037:Ckap2l UTSW 2 129270649 small deletion probably benign
Z1176:Ckap2l UTSW 2 129285362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCAAAGCCCAGTGTCAC -3'
(R):5'- CTGTAAAGCAGTTGACTTCACATC -3'

Sequencing Primer
(F):5'- GGCAAAGCCTCATTTTCACGG -3'
(R):5'- GTTGACTTCACATCAAAACCATCTTC -3'
Posted On2016-02-04