Mutagenetix > Incidental Mutations

Incidental Mutation 'R4803:Vps16'

370445

Institutional Source

Beutler Lab

Gene Symbol

Vps16

Ensembl Gene

ENSMUSG00000027411

Gene Name

VSP16 CORVET/HOPS core subunit

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R4803 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130424339-130444269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 130438110 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 85 (P85L)

Ref Sequence

ENSEMBL: ENSMUSP00000028900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]

Predicted Effect

probably benign
Transcript: ENSMUST00000028900
AA Change: P85L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: P85L

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	420	1e-166	PFAM
low complexity region	452	462	N/A	INTRINSIC
Pfam:Vps16_C	517	835	5.5e-150	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125973

Predicted Effect

probably benign
Transcript: ENSMUST00000128994
AA Change: P85L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: P85L

Domain	Start	End	E-Value	Type
Pfam:Vps16_N	4	212	3.2e-74	PFAM
Pfam:Vps16_N	205	316	1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137084

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Anxa8	T	A	14: 34,092,622		probably null	Het
Ap4e1	A	G	2: 127,049,559	I83M	probably benign	Het
Arhgap44	G	C	11: 65,053,095	P197A	probably benign	Het
Asb1	T	A	1: 91,552,329	V157E	probably damaging	Het
B3gat1	T	A	9: 26,755,690	Y73N	probably benign	Het
Bmp8a	G	A	4: 123,324,569	T219I	possibly damaging	Het
Cacna1c	G	A	6: 118,751,541	S285F	probably damaging	Het
Cd163	A	G	6: 124,312,430	D369G	probably damaging	Het
Ckap2l	C	T	2: 129,269,256	G674R	probably damaging	Het
Cog2	A	G	8: 124,535,451	Y276C	probably damaging	Het
Col16a1	A	T	4: 130,055,108		probably benign	Het
Col5a1	G	A	2: 28,011,341	G1282R	unknown	Het
Cyp2c29	A	T	19: 39,324,995	M351L	probably benign	Het
Cyp4f15	T	A	17: 32,692,580	D145E	probably benign	Het
Defb48	T	C	14: 62,984,457	Y4C	unknown	Het
Dnaaf3	T	C	7: 4,526,904	Q292R	probably benign	Het
Dnah11	T	C	12: 118,127,608	M930V	possibly damaging	Het
Dnaja2	A	T	8: 85,553,400	I50K	probably damaging	Het
Dnm2	A	G	9: 21,474,629	N316S	probably damaging	Het
Dusp12	A	G	1: 170,880,606	Y181H	possibly damaging	Het
Efemp1	T	G	11: 28,921,795	F437V	possibly damaging	Het
Eps8l3	T	A	3: 107,891,009	V464D	probably damaging	Het
Fat2	A	T	11: 55,285,060	L1609Q	probably benign	Het
Fbxw24	C	T	9: 109,624,842	V79I	probably benign	Het
Fgl2	A	T	5: 21,375,920	Q420L	probably benign	Het
Filip1	T	C	9: 79,820,114	K408E	probably benign	Het
Fkbp9	A	C	6: 56,875,707	I471L	probably benign	Het
Fndc1	A	T	17: 7,753,706	S1465T	probably damaging	Het
Fry	A	T	5: 150,399,533	T1050S	probably benign	Het
Gm12258	G	A	11: 58,859,030	V344I	probably benign	Het
Gm5434	T	A	12: 36,090,730		probably benign	Het
Gtf3c1	A	G	7: 125,663,540	V1049A	probably damaging	Het
Ireb2	A	G	9: 54,906,814	E829G	probably benign	Het
Itih5	G	A	2: 10,240,581	V494I	probably benign	Het
Krt75	A	T	15: 101,568,072	D419E	probably benign	Het
Lama1	T	C	17: 67,809,271	S2378P	probably damaging	Het
Lcorl	T	A	5: 45,747,281		probably null	Het
Man2a1	A	T	17: 64,659,009	H314L	probably damaging	Het
Mthfd1l	T	A	10: 4,007,840	H292Q	possibly damaging	Het
Ocm	A	T	5: 144,023,868	M87K	possibly damaging	Het
Olfr1193	A	T	2: 88,678,022	S56C	probably benign	Het
Olfr1451	T	C	19: 12,999,169	L61P	probably damaging	Het
Olfr482	A	C	7: 108,095,459	I37S	probably damaging	Het
Olfr677	A	C	7: 105,056,656	I137L	probably benign	Het
Olfr891	C	A	9: 38,180,250	S191I	probably damaging	Het
Olfr951	A	G	9: 39,394,636	T282A	probably benign	Het
Oplah	A	G	15: 76,302,768	Y616H	probably damaging	Het
Pde3a	G	A	6: 141,459,086	V346M	probably damaging	Het
Pdlim1	T	A	19: 40,243,448	E162V	possibly damaging	Het
Pdzd2	C	G	15: 12,374,595	S1818T	probably benign	Het
Phf24	G	A	4: 42,933,731	G38S	probably damaging	Het
Plekhg1	T	C	10: 3,957,186	V701A	probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Ptprz1	A	G	6: 23,001,546	S1212G	probably benign	Het
Rab3il1	C	A	19: 10,027,444	Q110K	possibly damaging	Het
Rin3	A	T	12: 102,361,383		probably benign	Het
Rps6kb2	T	A	19: 4,158,678	K280*	probably null	Het
Slc27a6	G	T	18: 58,572,033	L162F	possibly damaging	Het
Slc6a19	T	A	13: 73,684,042	I472F	possibly damaging	Het
Spatc1l	G	A	10: 76,569,372	R196Q	probably damaging	Het
Srp72	T	C	5: 76,984,384	I273T	probably damaging	Het
St8sia1	C	A	6: 142,867,923	S171I	probably benign	Het
Tas2r136	T	C	6: 132,777,492	H224R	probably damaging	Het
Tas2r140	A	G	6: 133,055,780	V5A	possibly damaging	Het
Tbce	C	T	13: 14,019,861	R71H	probably damaging	Het
Tdrd9	A	T	12: 111,996,835	K115*	probably null	Het
Thada	T	A	17: 84,272,817	H1403L	probably damaging	Het
Thap1	AGCAGCATCTGCTCG	AG	8: 26,160,854		probably null	Het
Timm44	A	G	8: 4,267,932	S159P	probably damaging	Het
Tlk2	T	A	11: 105,281,100	C699S	probably damaging	Het
Tmem178b	A	G	6: 40,004,226	K65R	probably damaging	Het
Ttc28	T	C	5: 111,277,463	V1718A	possibly damaging	Het
Ttc6	T	G	12: 57,728,505	C1662W	probably damaging	Het
Unc13a	C	A	8: 71,662,850		probably null	Het
Vip	A	T	10: 5,644,099	I151F	probably damaging	Het
Wdsub1	T	C	2: 59,870,399		probably benign	Het
Zc3h12c	T	C	9: 52,116,553	D503G	probably damaging	Het

Other mutations in Vps16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Vps16	APN	2	130437696	missense	probably benign	0.19
IGL01400:Vps16	APN	2	130438353	missense	possibly damaging	0.73
IGL01542:Vps16	APN	2	130438394	missense	probably damaging	0.97
IGL02011:Vps16	APN	2	130441479	missense	probably benign	0.04
IGL02192:Vps16	APN	2	130440932	missense	probably damaging	0.98
IGL02220:Vps16	APN	2	130441653	missense	possibly damaging	0.85
IGL02587:Vps16	APN	2	130439716	critical splice donor site	probably null
R0427:Vps16	UTSW	2	130438850	missense	probably benign	0.00
R0507:Vps16	UTSW	2	130437712	critical splice donor site	probably null
R1550:Vps16	UTSW	2	130440340	missense	probably benign	0.09
R1789:Vps16	UTSW	2	130443600	missense	probably benign	0.42
R3895:Vps16	UTSW	2	130438676	missense	possibly damaging	0.96
R3981:Vps16	UTSW	2	130442594	missense	possibly damaging	0.77
R4092:Vps16	UTSW	2	130439912	missense	probably damaging	1.00
R4555:Vps16	UTSW	2	130443576	missense	probably damaging	1.00
R4569:Vps16	UTSW	2	130442204	missense	probably benign
R4835:Vps16	UTSW	2	130438300	splice site	probably benign
R5022:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5023:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5057:Vps16	UTSW	2	130439452	missense	probably benign	0.07
R5158:Vps16	UTSW	2	130441279	missense	probably damaging	1.00
R5177:Vps16	UTSW	2	130443368	nonsense	probably null
R5540:Vps16	UTSW	2	130442385	missense	probably benign	0.00
R5680:Vps16	UTSW	2	130440324	missense	possibly damaging	0.64
R5689:Vps16	UTSW	2	130439091	nonsense	probably null
R5690:Vps16	UTSW	2	130439091	nonsense	probably null
R5926:Vps16	UTSW	2	130443556	missense	probably damaging	0.97
R5992:Vps16	UTSW	2	130424449	critical splice donor site	probably null
R6135:Vps16	UTSW	2	130438653	missense	possibly damaging	0.57
R6370:Vps16	UTSW	2	130443384	missense	probably damaging	1.00
R6898:Vps16	UTSW	2	130437681	missense	possibly damaging	0.74
R7378:Vps16	UTSW	2	130438179	missense	probably damaging	1.00
R7487:Vps16	UTSW	2	130439057	nonsense	probably null
R7641:Vps16	UTSW	2	130440528	missense	probably benign	0.28
R7720:Vps16	UTSW	2	130441703	nonsense	probably null
R8246:Vps16	UTSW	2	130438873	missense	probably damaging	1.00
R8363:Vps16	UTSW	2	130442241	missense	probably benign	0.08
RF021:Vps16	UTSW	2	130438209	missense	probably benign	0.09
Z1177:Vps16	UTSW	2	130441426	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTACTGAGGAACTGTTGGAG -3'
(R):5'- GACACGGTTCTGAAGCACTTC -3'

Sequencing Primer
(F):5'- TCTACTGAGGAACTGTTGGAGAAAAG -3'
(R):5'- CTTCCTAACAAGATGGACCGTGG -3'

Posted On

2016-02-04