Incidental Mutation 'R4803:Vps16'
ID370445
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130438110 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 85 (P85L)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: P85L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: P85L

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
AA Change: P85L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411
AA Change: P85L

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTACTGAGGAACTGTTGGAG -3'
(R):5'- GACACGGTTCTGAAGCACTTC -3'

Sequencing Primer
(F):5'- TCTACTGAGGAACTGTTGGAGAAAAG -3'
(R):5'- CTTCCTAACAAGATGGACCGTGG -3'
Posted On2016-02-04