Mutagenetix > Incidental Mutations

Incidental Mutation 'R4803:Pde3a'

370465

Institutional Source

Beutler Lab

Gene Symbol

Pde3a

Ensembl Gene

ENSMUSG00000041741

Gene Name

phosphodiesterase 3A, cGMP inhibited

Synonyms

A930022O17Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R4803 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141249269-141507448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141459086 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 346 (V346M)

Ref Sequence

ENSEMBL: ENSMUSP00000038749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043259]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043259
AA Change: V346M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: V346M

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	103	121	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
transmembrane domain	230	252	N/A	INTRINSIC
low complexity region	419	445	N/A	INTRINSIC
low complexity region	520	544	N/A	INTRINSIC
HDc	749	964	3.76e-4	SMART
low complexity region	1028	1056	N/A	INTRINSIC
low complexity region	1114	1133	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189060

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Anxa8	T	A	14: 34,092,622		probably null	Het
Ap4e1	A	G	2: 127,049,559	I83M	probably benign	Het
Arhgap44	G	C	11: 65,053,095	P197A	probably benign	Het
Asb1	T	A	1: 91,552,329	V157E	probably damaging	Het
B3gat1	T	A	9: 26,755,690	Y73N	probably benign	Het
Bmp8a	G	A	4: 123,324,569	T219I	possibly damaging	Het
Cacna1c	G	A	6: 118,751,541	S285F	probably damaging	Het
Cd163	A	G	6: 124,312,430	D369G	probably damaging	Het
Ckap2l	C	T	2: 129,269,256	G674R	probably damaging	Het
Cog2	A	G	8: 124,535,451	Y276C	probably damaging	Het
Col16a1	A	T	4: 130,055,108		probably benign	Het
Col5a1	G	A	2: 28,011,341	G1282R	unknown	Het
Cyp2c29	A	T	19: 39,324,995	M351L	probably benign	Het
Cyp4f15	T	A	17: 32,692,580	D145E	probably benign	Het
Defb48	T	C	14: 62,984,457	Y4C	unknown	Het
Dnaaf3	T	C	7: 4,526,904	Q292R	probably benign	Het
Dnah11	T	C	12: 118,127,608	M930V	possibly damaging	Het
Dnaja2	A	T	8: 85,553,400	I50K	probably damaging	Het
Dnm2	A	G	9: 21,474,629	N316S	probably damaging	Het
Dusp12	A	G	1: 170,880,606	Y181H	possibly damaging	Het
Efemp1	T	G	11: 28,921,795	F437V	possibly damaging	Het
Eps8l3	T	A	3: 107,891,009	V464D	probably damaging	Het
Fat2	A	T	11: 55,285,060	L1609Q	probably benign	Het
Fbxw24	C	T	9: 109,624,842	V79I	probably benign	Het
Fgl2	A	T	5: 21,375,920	Q420L	probably benign	Het
Filip1	T	C	9: 79,820,114	K408E	probably benign	Het
Fkbp9	A	C	6: 56,875,707	I471L	probably benign	Het
Fndc1	A	T	17: 7,753,706	S1465T	probably damaging	Het
Fry	A	T	5: 150,399,533	T1050S	probably benign	Het
Gm12258	G	A	11: 58,859,030	V344I	probably benign	Het
Gm5434	T	A	12: 36,090,730		probably benign	Het
Gtf3c1	A	G	7: 125,663,540	V1049A	probably damaging	Het
Ireb2	A	G	9: 54,906,814	E829G	probably benign	Het
Itih5	G	A	2: 10,240,581	V494I	probably benign	Het
Krt75	A	T	15: 101,568,072	D419E	probably benign	Het
Lama1	T	C	17: 67,809,271	S2378P	probably damaging	Het
Lcorl	T	A	5: 45,747,281		probably null	Het
Man2a1	A	T	17: 64,659,009	H314L	probably damaging	Het
Mthfd1l	T	A	10: 4,007,840	H292Q	possibly damaging	Het
Ocm	A	T	5: 144,023,868	M87K	possibly damaging	Het
Olfr1193	A	T	2: 88,678,022	S56C	probably benign	Het
Olfr1451	T	C	19: 12,999,169	L61P	probably damaging	Het
Olfr482	A	C	7: 108,095,459	I37S	probably damaging	Het
Olfr677	A	C	7: 105,056,656	I137L	probably benign	Het
Olfr891	C	A	9: 38,180,250	S191I	probably damaging	Het
Olfr951	A	G	9: 39,394,636	T282A	probably benign	Het
Oplah	A	G	15: 76,302,768	Y616H	probably damaging	Het
Pdlim1	T	A	19: 40,243,448	E162V	possibly damaging	Het
Pdzd2	C	G	15: 12,374,595	S1818T	probably benign	Het
Phf24	G	A	4: 42,933,731	G38S	probably damaging	Het
Plekhg1	T	C	10: 3,957,186	V701A	probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Ptprz1	A	G	6: 23,001,546	S1212G	probably benign	Het
Rab3il1	C	A	19: 10,027,444	Q110K	possibly damaging	Het
Rin3	A	T	12: 102,361,383		probably benign	Het
Rps6kb2	T	A	19: 4,158,678	K280*	probably null	Het
Slc27a6	G	T	18: 58,572,033	L162F	possibly damaging	Het
Slc6a19	T	A	13: 73,684,042	I472F	possibly damaging	Het
Spatc1l	G	A	10: 76,569,372	R196Q	probably damaging	Het
Srp72	T	C	5: 76,984,384	I273T	probably damaging	Het
St8sia1	C	A	6: 142,867,923	S171I	probably benign	Het
Tas2r136	T	C	6: 132,777,492	H224R	probably damaging	Het
Tas2r140	A	G	6: 133,055,780	V5A	possibly damaging	Het
Tbce	C	T	13: 14,019,861	R71H	probably damaging	Het
Tdrd9	A	T	12: 111,996,835	K115*	probably null	Het
Thada	T	A	17: 84,272,817	H1403L	probably damaging	Het
Thap1	AGCAGCATCTGCTCG	AG	8: 26,160,854		probably null	Het
Timm44	A	G	8: 4,267,932	S159P	probably damaging	Het
Tlk2	T	A	11: 105,281,100	C699S	probably damaging	Het
Tmem178b	A	G	6: 40,004,226	K65R	probably damaging	Het
Ttc28	T	C	5: 111,277,463	V1718A	possibly damaging	Het
Ttc6	T	G	12: 57,728,505	C1662W	probably damaging	Het
Unc13a	C	A	8: 71,662,850		probably null	Het
Vip	A	T	10: 5,644,099	I151F	probably damaging	Het
Vps16	C	T	2: 130,438,110	P85L	probably benign	Het
Wdsub1	T	C	2: 59,870,399		probably benign	Het
Zc3h12c	T	C	9: 52,116,553	D503G	probably damaging	Het

Other mutations in Pde3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Pde3a	APN	6	141459738	missense	probably damaging	1.00
IGL01400:Pde3a	APN	6	141459228	missense	probably benign	0.02
IGL01752:Pde3a	APN	6	141487613	splice site	probably benign
IGL01819:Pde3a	APN	6	141487537	missense	probably damaging	1.00
IGL02014:Pde3a	APN	6	141459144	missense	probably null	1.00
IGL02119:Pde3a	APN	6	141459803	missense	probably damaging	0.97
IGL02465:Pde3a	APN	6	141249675	missense	possibly damaging	0.53
IGL02677:Pde3a	APN	6	141405172	splice site	probably benign
IGL02961:Pde3a	APN	6	141459700	nonsense	probably null
IGL03034:Pde3a	APN	6	141492400	splice site	probably benign
IGL03142:Pde3a	APN	6	141492299	missense	probably benign	0.01
PIT4305001:Pde3a	UTSW	6	141492310	missense	probably benign	0.04
R0412:Pde3a	UTSW	6	141498684	missense	probably damaging	1.00
R0517:Pde3a	UTSW	6	141498657	nonsense	probably null
R0573:Pde3a	UTSW	6	141492231	missense	probably damaging	1.00
R0621:Pde3a	UTSW	6	141249999	missense	probably damaging	1.00
R0781:Pde3a	UTSW	6	141459316	splice site	probably benign
R1065:Pde3a	UTSW	6	141476732	splice site	probably benign
R1110:Pde3a	UTSW	6	141459316	splice site	probably benign
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1480:Pde3a	UTSW	6	141487574	missense	probably benign	0.17
R1559:Pde3a	UTSW	6	141459098	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141250353	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141487513	missense	probably damaging	1.00
R1902:Pde3a	UTSW	6	141498770	missense	probably benign
R1909:Pde3a	UTSW	6	141250239	missense	probably benign	0.00
R2048:Pde3a	UTSW	6	141489006	splice site	probably benign
R2144:Pde3a	UTSW	6	141490111	missense	probably benign	0.40
R2155:Pde3a	UTSW	6	141483914	missense	possibly damaging	0.70
R2208:Pde3a	UTSW	6	141250347	missense	probably damaging	0.97
R2405:Pde3a	UTSW	6	141481242	missense	probably damaging	1.00
R4592:Pde3a	UTSW	6	141459216	missense	probably benign	0.13
R4677:Pde3a	UTSW	6	141466139	missense	probably benign	0.02
R4887:Pde3a	UTSW	6	141470942	missense	possibly damaging	0.94
R4999:Pde3a	UTSW	6	141250025	missense	probably benign	0.00
R5055:Pde3a	UTSW	6	141487956	nonsense	probably null
R5181:Pde3a	UTSW	6	141481255	critical splice donor site	probably null
R5640:Pde3a	UTSW	6	141483915	missense	probably damaging	0.99
R5694:Pde3a	UTSW	6	141250502	missense	possibly damaging	0.48
R6176:Pde3a	UTSW	6	141498889	missense	possibly damaging	0.96
R6394:Pde3a	UTSW	6	141487511	missense	probably damaging	1.00
R6692:Pde3a	UTSW	6	141479346	missense	probably damaging	1.00
R6968:Pde3a	UTSW	6	141487932	missense	probably damaging	1.00
R7137:Pde3a	UTSW	6	141498746	missense	probably benign	0.26
R7163:Pde3a	UTSW	6	141487544	missense	probably damaging	1.00
R7677:Pde3a	UTSW	6	141250257	missense	probably damaging	1.00
R7754:Pde3a	UTSW	6	141459249	missense	probably benign	0.32
R8037:Pde3a	UTSW	6	141483924	missense	possibly damaging	0.82
R8123:Pde3a	UTSW	6	141466191	missense	probably benign	0.00
R8206:Pde3a	UTSW	6	141487885	missense	probably damaging	1.00
R8262:Pde3a	UTSW	6	141487801	missense	possibly damaging	0.89
R8376:Pde3a	UTSW	6	141481221	missense	possibly damaging	0.50
R8893:Pde3a	UTSW	6	141459796	missense	probably damaging	1.00
X0053:Pde3a	UTSW	6	141483969	splice site	probably null
X0062:Pde3a	UTSW	6	141249984	missense	probably damaging	1.00
Z1177:Pde3a	UTSW	6	141250469	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GGCTTAGCTGAATTTGCTTTCC -3'
(R):5'- TAGTTCTCACTGAAGGTCACG -3'

Sequencing Primer
(F):5'- GAGGTAACACAGGGTCTTCTCTTAC -3'
(R):5'- TCACTGAAGGTCACGGTGGG -3'

Posted On

2016-02-04