Incidental Mutation 'R4803:Pde3a'
ID 370465
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Name phosphodiesterase 3A, cGMP inhibited
Synonyms A930022O17Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R4803 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 141194995-141452588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 141404812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 346 (V346M)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
AlphaFold Q9Z0X4
Predicted Effect probably damaging
Transcript: ENSMUST00000043259
AA Change: V346M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: V346M

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189060
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Anxa8 T A 14: 33,814,579 (GRCm39) probably null Het
Ap4e1 A G 2: 126,891,479 (GRCm39) I83M probably benign Het
Arhgap44 G C 11: 64,943,921 (GRCm39) P197A probably benign Het
Asb1 T A 1: 91,480,051 (GRCm39) V157E probably damaging Het
B3gat1 T A 9: 26,666,986 (GRCm39) Y73N probably benign Het
Bmp8a G A 4: 123,218,362 (GRCm39) T219I possibly damaging Het
Cacna1c G A 6: 118,728,502 (GRCm39) S285F probably damaging Het
Cd163 A G 6: 124,289,389 (GRCm39) D369G probably damaging Het
Ckap2l C T 2: 129,111,176 (GRCm39) G674R probably damaging Het
Cog2 A G 8: 125,262,190 (GRCm39) Y276C probably damaging Het
Col16a1 A T 4: 129,948,901 (GRCm39) probably benign Het
Col5a1 G A 2: 27,901,353 (GRCm39) G1282R unknown Het
Cyp2c29 A T 19: 39,313,439 (GRCm39) M351L probably benign Het
Cyp4f15 T A 17: 32,911,554 (GRCm39) D145E probably benign Het
Defb48 T C 14: 63,221,906 (GRCm39) Y4C unknown Het
Dnaaf3 T C 7: 4,529,903 (GRCm39) Q292R probably benign Het
Dnah11 T C 12: 118,091,343 (GRCm39) M930V possibly damaging Het
Dnaja2 A T 8: 86,280,029 (GRCm39) I50K probably damaging Het
Dnm2 A G 9: 21,385,925 (GRCm39) N316S probably damaging Het
Dusp12 A G 1: 170,708,175 (GRCm39) Y181H possibly damaging Het
Efemp1 T G 11: 28,871,795 (GRCm39) F437V possibly damaging Het
Eps8l3 T A 3: 107,798,325 (GRCm39) V464D probably damaging Het
Fat2 A T 11: 55,175,886 (GRCm39) L1609Q probably benign Het
Fbxw24 C T 9: 109,453,910 (GRCm39) V79I probably benign Het
Fgl2 A T 5: 21,580,918 (GRCm39) Q420L probably benign Het
Filip1 T C 9: 79,727,396 (GRCm39) K408E probably benign Het
Fkbp9 A C 6: 56,852,692 (GRCm39) I471L probably benign Het
Fndc1 A T 17: 7,972,538 (GRCm39) S1465T probably damaging Het
Fry A T 5: 150,322,998 (GRCm39) T1050S probably benign Het
Gm12258 G A 11: 58,749,856 (GRCm39) V344I probably benign Het
Gtf3c1 A G 7: 125,262,712 (GRCm39) V1049A probably damaging Het
Ireb2 A G 9: 54,814,098 (GRCm39) E829G probably benign Het
Itih5 G A 2: 10,245,392 (GRCm39) V494I probably benign Het
Krt75 A T 15: 101,476,507 (GRCm39) D419E probably benign Het
Lama1 T C 17: 68,116,266 (GRCm39) S2378P probably damaging Het
Lcorl T A 5: 45,904,623 (GRCm39) probably null Het
Man2a1 A T 17: 64,966,004 (GRCm39) H314L probably damaging Het
Mthfd1l T A 10: 3,957,840 (GRCm39) H292Q possibly damaging Het
Ocm A T 5: 143,960,686 (GRCm39) M87K possibly damaging Het
Oplah A G 15: 76,186,968 (GRCm39) Y616H probably damaging Het
Or4s2b A T 2: 88,508,366 (GRCm39) S56C probably benign Het
Or52e4 A C 7: 104,705,863 (GRCm39) I137L probably benign Het
Or5b99 T C 19: 12,976,533 (GRCm39) L61P probably damaging Het
Or5p58 A C 7: 107,694,666 (GRCm39) I37S probably damaging Het
Or8c13 C A 9: 38,091,546 (GRCm39) S191I probably damaging Het
Or8g32 A G 9: 39,305,932 (GRCm39) T282A probably benign Het
Pdlim1 T A 19: 40,231,892 (GRCm39) E162V possibly damaging Het
Pdzd2 C G 15: 12,374,681 (GRCm39) S1818T probably benign Het
Phf24 G A 4: 42,933,731 (GRCm39) G38S probably damaging Het
Plekhg1 T C 10: 3,907,186 (GRCm39) V701A probably benign Het
Ppard C G 17: 28,505,348 (GRCm39) R12G unknown Het
Ptprz1 A G 6: 23,001,545 (GRCm39) S1212G probably benign Het
Rab3il1 C A 19: 10,004,808 (GRCm39) Q110K possibly damaging Het
Rin3 A T 12: 102,327,642 (GRCm39) probably benign Het
Rps6kb2 T A 19: 4,208,677 (GRCm39) K280* probably null Het
Slc27a6 G T 18: 58,705,105 (GRCm39) L162F possibly damaging Het
Slc6a19 T A 13: 73,832,161 (GRCm39) I472F possibly damaging Het
Spatc1l G A 10: 76,405,206 (GRCm39) R196Q probably damaging Het
Srp72 T C 5: 77,132,231 (GRCm39) I273T probably damaging Het
St8sia1 C A 6: 142,813,649 (GRCm39) S171I probably benign Het
Tas2r136 T C 6: 132,754,455 (GRCm39) H224R probably damaging Het
Tas2r140 A G 6: 133,032,743 (GRCm39) V5A possibly damaging Het
Tbce C T 13: 14,194,446 (GRCm39) R71H probably damaging Het
Tdrd9 A T 12: 111,963,269 (GRCm39) K115* probably null Het
Thada T A 17: 84,580,245 (GRCm39) H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,650,882 (GRCm39) probably null Het
Timm44 A G 8: 4,317,932 (GRCm39) S159P probably damaging Het
Tlk2 T A 11: 105,171,926 (GRCm39) C699S probably damaging Het
Tmem178b A G 6: 39,981,160 (GRCm39) K65R probably damaging Het
Ttc28 T C 5: 111,425,329 (GRCm39) V1718A possibly damaging Het
Ttc6 T G 12: 57,775,291 (GRCm39) C1662W probably damaging Het
Ube2frt T A 12: 36,140,729 (GRCm39) probably benign Het
Unc13a C A 8: 72,115,494 (GRCm39) probably null Het
Vip A T 10: 5,594,099 (GRCm39) I151F probably damaging Het
Vps16 C T 2: 130,280,030 (GRCm39) P85L probably benign Het
Wdsub1 T C 2: 59,700,743 (GRCm39) probably benign Het
Zc3h12c T C 9: 52,027,853 (GRCm39) D503G probably damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141,405,464 (GRCm39) missense probably damaging 1.00
IGL01400:Pde3a APN 6 141,404,954 (GRCm39) missense probably benign 0.02
IGL01752:Pde3a APN 6 141,433,339 (GRCm39) splice site probably benign
IGL01819:Pde3a APN 6 141,433,263 (GRCm39) missense probably damaging 1.00
IGL02014:Pde3a APN 6 141,404,870 (GRCm39) missense probably null 1.00
IGL02119:Pde3a APN 6 141,405,529 (GRCm39) missense probably damaging 0.97
IGL02465:Pde3a APN 6 141,195,401 (GRCm39) missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141,350,898 (GRCm39) splice site probably benign
IGL02961:Pde3a APN 6 141,405,426 (GRCm39) nonsense probably null
IGL03034:Pde3a APN 6 141,438,126 (GRCm39) splice site probably benign
IGL03142:Pde3a APN 6 141,438,025 (GRCm39) missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141,438,036 (GRCm39) missense probably benign 0.04
R0412:Pde3a UTSW 6 141,444,410 (GRCm39) missense probably damaging 1.00
R0517:Pde3a UTSW 6 141,444,383 (GRCm39) nonsense probably null
R0573:Pde3a UTSW 6 141,437,957 (GRCm39) missense probably damaging 1.00
R0621:Pde3a UTSW 6 141,195,725 (GRCm39) missense probably damaging 1.00
R0781:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1065:Pde3a UTSW 6 141,422,458 (GRCm39) splice site probably benign
R1110:Pde3a UTSW 6 141,405,042 (GRCm39) splice site probably benign
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1462:Pde3a UTSW 6 141,405,560 (GRCm39) missense probably benign 0.05
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1470:Pde3a UTSW 6 141,411,932 (GRCm39) missense probably benign 0.41
R1480:Pde3a UTSW 6 141,433,300 (GRCm39) missense probably benign 0.17
R1559:Pde3a UTSW 6 141,404,824 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,433,239 (GRCm39) missense probably damaging 1.00
R1862:Pde3a UTSW 6 141,196,079 (GRCm39) missense probably damaging 1.00
R1902:Pde3a UTSW 6 141,444,496 (GRCm39) missense probably benign
R1909:Pde3a UTSW 6 141,195,965 (GRCm39) missense probably benign 0.00
R2048:Pde3a UTSW 6 141,434,732 (GRCm39) splice site probably benign
R2144:Pde3a UTSW 6 141,435,837 (GRCm39) missense probably benign 0.40
R2155:Pde3a UTSW 6 141,429,640 (GRCm39) missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141,196,073 (GRCm39) missense probably damaging 0.97
R2405:Pde3a UTSW 6 141,426,968 (GRCm39) missense probably damaging 1.00
R4592:Pde3a UTSW 6 141,404,942 (GRCm39) missense probably benign 0.13
R4677:Pde3a UTSW 6 141,411,865 (GRCm39) missense probably benign 0.02
R4887:Pde3a UTSW 6 141,416,668 (GRCm39) missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141,195,751 (GRCm39) missense probably benign 0.00
R5055:Pde3a UTSW 6 141,433,682 (GRCm39) nonsense probably null
R5181:Pde3a UTSW 6 141,426,981 (GRCm39) critical splice donor site probably null
R5640:Pde3a UTSW 6 141,429,641 (GRCm39) missense probably damaging 0.99
R5694:Pde3a UTSW 6 141,196,228 (GRCm39) missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141,444,615 (GRCm39) missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141,433,237 (GRCm39) missense probably damaging 1.00
R6692:Pde3a UTSW 6 141,425,072 (GRCm39) missense probably damaging 1.00
R6968:Pde3a UTSW 6 141,433,658 (GRCm39) missense probably damaging 1.00
R7137:Pde3a UTSW 6 141,444,472 (GRCm39) missense probably benign 0.26
R7163:Pde3a UTSW 6 141,433,270 (GRCm39) missense probably damaging 1.00
R7677:Pde3a UTSW 6 141,195,983 (GRCm39) missense probably damaging 1.00
R7754:Pde3a UTSW 6 141,404,975 (GRCm39) missense probably benign 0.32
R8037:Pde3a UTSW 6 141,429,650 (GRCm39) missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141,411,917 (GRCm39) missense probably benign 0.00
R8206:Pde3a UTSW 6 141,433,611 (GRCm39) missense probably damaging 1.00
R8262:Pde3a UTSW 6 141,433,527 (GRCm39) missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141,426,947 (GRCm39) missense possibly damaging 0.50
R8893:Pde3a UTSW 6 141,405,522 (GRCm39) missense probably damaging 1.00
R9037:Pde3a UTSW 6 141,416,832 (GRCm39) missense probably damaging 1.00
R9158:Pde3a UTSW 6 141,195,614 (GRCm39) missense probably benign
R9222:Pde3a UTSW 6 141,437,904 (GRCm39) missense probably damaging 1.00
R9318:Pde3a UTSW 6 141,425,202 (GRCm39) missense probably benign 0.01
R9385:Pde3a UTSW 6 141,437,982 (GRCm39) missense probably benign 0.30
X0053:Pde3a UTSW 6 141,429,695 (GRCm39) splice site probably null
X0062:Pde3a UTSW 6 141,195,710 (GRCm39) missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141,196,195 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGCTTAGCTGAATTTGCTTTCC -3'
(R):5'- TAGTTCTCACTGAAGGTCACG -3'

Sequencing Primer
(F):5'- GAGGTAACACAGGGTCTTCTCTTAC -3'
(R):5'- TCACTGAAGGTCACGGTGGG -3'
Posted On 2016-02-04