Incidental Mutation 'R0421:Plk3'
ID37047
Institutional Source Beutler Lab
Gene Symbol Plk3
Ensembl Gene ENSMUSG00000028680
Gene Namepolo like kinase 3
SynonymsCnk
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0421 (G1)
Quality Score208
Status Validated
Chromosome4
Chromosomal Location117128655-117133963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117133444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062206] [ENSMUST00000076859] [ENSMUST00000144269]
Predicted Effect probably benign
Transcript: ENSMUST00000062206
SMART Domains Protein: ENSMUSP00000052243
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 121 217 3.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076859
AA Change: V91A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076130
Gene: ENSMUSG00000028680
AA Change: V91A

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
S_TKc 63 315 2.15e-96 SMART
Pfam:POLO_box 473 534 2.7e-16 PFAM
low complexity region 554 566 N/A INTRINSIC
Pfam:POLO_box 570 638 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126135
Predicted Effect probably benign
Transcript: ENSMUST00000144269
SMART Domains Protein: ENSMUSP00000122605
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 118 178 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147730
AA Change: V69A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120476
Gene: ENSMUSG00000028680
AA Change: V69A

DomainStartEndE-ValueType
low complexity region 1 9 N/A INTRINSIC
S_TKc 42 294 2.15e-96 SMART
Pfam:POLO_box 435 496 5.3e-17 PFAM
low complexity region 516 528 N/A INTRINSIC
Pfam:POLO_box 532 600 2.3e-16 PFAM
Meta Mutation Damage Score 0.4191 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a member of the highly conserved polo-like kinase family of serine/threonine kinases. Members of this family are characterized by an amino-terminal catalytic domain and a carboxy-terminal bipartite polo box domain that functions as a substrate-binding motif and a cellular localization signal. Polo-like kinases have primarily been implicated in cell cycle regulation. In mouse, this protein that has been reported to localize to the nucleolus during interphase but is undetectable during mitosis, following nucleolus dissociation during prophase. The protein relocalizes to the nucleolus just prior to cytokinesis and peak levels are detected during G1 of interphase. This gene has been implicated in regulation of entry into S phase, with RNAi-induced depletion resulting in failure to re-enter the cell cycle. Mice deficient for this gene exhibit increased weight and tumor development at advanced age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Aged mice homozygous for a null allele develop tumors in various organs at an accelerated rate while mouse embryonic fibroblasts are hypersensitive to the induction of HIF-1alpha under hypoxic conditions or by nickel and cobalt ion treatments. Homozygotes for another null allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Plk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Plk3 APN 4 117132997 nonsense probably null
IGL01647:Plk3 APN 4 117130357 missense probably damaging 1.00
IGL02516:Plk3 APN 4 117131989 missense probably damaging 0.99
IGL03340:Plk3 APN 4 117132928 missense probably damaging 0.98
PIT4283001:Plk3 UTSW 4 117133292 missense probably damaging 1.00
R1074:Plk3 UTSW 4 117131758 missense probably damaging 1.00
R1612:Plk3 UTSW 4 117131807 missense probably damaging 1.00
R3813:Plk3 UTSW 4 117133450 missense probably damaging 1.00
R3901:Plk3 UTSW 4 117133436 missense probably benign 0.13
R5232:Plk3 UTSW 4 117129120 missense probably benign 0.04
R5486:Plk3 UTSW 4 117130403 nonsense probably null
R5655:Plk3 UTSW 4 117131480 missense probably damaging 1.00
R6612:Plk3 UTSW 4 117132737 nonsense probably null
R7127:Plk3 UTSW 4 117130570 missense probably benign 0.39
R7380:Plk3 UTSW 4 117131153 missense probably benign
R7748:Plk3 UTSW 4 117131728 missense probably damaging 1.00
R7839:Plk3 UTSW 4 117129330 missense probably damaging 1.00
R7922:Plk3 UTSW 4 117129330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCACTGTTTCAGACCCCGC -3'
(R):5'- ACCTACACCAAGGGTCGCTTGTTG -3'

Sequencing Primer
(F):5'- GTCAGCATCCTCGAAATGATGTG -3'
(R):5'- TCGCTTGTTGGGCAAGG -3'
Posted On2013-05-09