Incidental Mutation 'R4803:Timm44'
ID 370471
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Name translocase of inner mitochondrial membrane 44
Synonyms Mimt44, 0710005E20Rik, Tim44, D8Ertd118e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R4803 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 4259731-4275913 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4267932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
AlphaFold O35857
Predicted Effect probably damaging
Transcript: ENSMUST00000003029
AA Change: S159P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: S159P

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161143
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
lassie UTSW 8 4260621 missense probably damaging 1.00
Togo UTSW 8 4270019 missense probably benign 0.10
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1842:Timm44 UTSW 8 4260510 critical splice donor site probably null
R1965:Timm44 UTSW 8 4260603 missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4267871 missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 splice site probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7844:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4266844 missense probably benign 0.02
R8532:Timm44 UTSW 8 4260549 missense possibly damaging 0.63
R8785:Timm44 UTSW 8 4270019 missense probably benign 0.10
R9003:Timm44 UTSW 8 4274204 missense possibly damaging 0.89
R9262:Timm44 UTSW 8 4260621 missense probably damaging 1.00
R9537:Timm44 UTSW 8 4260576 missense possibly damaging 0.90
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGACTCTACACCCTGCAG -3'
(R):5'- CACTTTTGTAAATGTTTCACGTGGC -3'

Sequencing Primer
(F):5'- CTGGGAGATGGCTTTGAA -3'
(R):5'- ACTCATGTCCATTCCAGGGAG -3'
Posted On 2016-02-04