Incidental Mutation 'R4803:B3gat1'
ID370477
Institutional Source Beutler Lab
Gene Symbol B3gat1
Ensembl Gene ENSMUSG00000045994
Gene Namebeta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
SynonymsGlcAT-P, 0710007K08Rik
Accession Numbers

Genbank: NM_029792; MGI: 1924148

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26733728-26763101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26755690 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 73 (Y73N)
Ref Sequence ENSEMBL: ENSMUSP00000124752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115269] [ENSMUST00000159799] [ENSMUST00000160899] [ENSMUST00000161115] [ENSMUST00000161431]
Predicted Effect probably benign
Transcript: ENSMUST00000115269
AA Change: Y86N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110924
Gene: ENSMUSG00000045994
AA Change: Y86N

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159527
SMART Domains Protein: ENSMUSP00000125401
Gene: ENSMUSG00000045994

DomainStartEndE-ValueType
Pfam:Glyco_transf_43 48 259 2.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159799
AA Change: Y86N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124438
Gene: ENSMUSG00000045994
AA Change: Y86N

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 329 6.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160899
AA Change: Y86N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124067
Gene: ENSMUSG00000045994
AA Change: Y86N

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Glyco_transf_43 118 328 1.7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161115
AA Change: Y73N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125700
Gene: ENSMUSG00000045994
AA Change: Y73N

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 316 3.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161431
AA Change: Y73N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124752
Gene: ENSMUSG00000045994
AA Change: Y73N

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_43 105 202 1.9e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glucuronyltransferase gene family. These enzymes exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product functions as the key enzyme in a glucuronyl transfer reaction during the biosynthesis of the carbohydrate epitope HNK-1 (human natural killer-1, also known as CD57 and LEU7). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced long term potentiation and impaired spatial learning. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Rps6kb2 T A 19: 4,158,678 K280* probably null Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in B3gat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:B3gat1 APN 9 26755910 missense possibly damaging 0.88
IGL01357:B3gat1 APN 9 26756987 missense probably damaging 1.00
IGL02140:B3gat1 APN 9 26757747 missense possibly damaging 0.63
R0098:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R0098:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R0234:B3gat1 UTSW 9 26756081 missense probably damaging 0.99
R0234:B3gat1 UTSW 9 26756081 missense probably damaging 0.99
R0944:B3gat1 UTSW 9 26756941 missense probably damaging 1.00
R1608:B3gat1 UTSW 9 26751816 missense probably damaging 1.00
R1957:B3gat1 UTSW 9 26755952 missense possibly damaging 0.86
R3401:B3gat1 UTSW 9 26755853 missense probably damaging 1.00
R3956:B3gat1 UTSW 9 26757028 missense possibly damaging 0.49
R4669:B3gat1 UTSW 9 26751756 missense probably benign 0.37
R4942:B3gat1 UTSW 9 26755598 missense probably benign 0.00
R6818:B3gat1 UTSW 9 26751702 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATATCAGAGCCAGGCCAGC -3'
(R):5'- GGCATCACCTCGCAGCTTATAG -3'

Sequencing Primer
(F):5'- ATGAGGGAAGTGACCCC -3'
(R):5'- AGTTGAGGCCAGTGTCGC -3'
Posted On2016-02-04