Incidental Mutation 'R0421:Zfp518b'
ID37051
Institutional Source Beutler Lab
Gene Symbol Zfp518b
Ensembl Gene ENSMUSG00000046572
Gene Namezinc finger protein 518B
Synonyms
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38668484-38684826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38674575 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 29 (P29L)
Ref Sequence ENSEMBL: ENSMUSP00000137381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057258] [ENSMUST00000178760] [ENSMUST00000179555] [ENSMUST00000180214]
Predicted Effect probably damaging
Transcript: ENSMUST00000057258
AA Change: P29L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061753
Gene: ENSMUSG00000046572
AA Change: P29L

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178760
Predicted Effect probably damaging
Transcript: ENSMUST00000179555
AA Change: P29L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137381
Gene: ENSMUSG00000046572
AA Change: P29L

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180214
AA Change: P29L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136948
Gene: ENSMUSG00000046572
AA Change: P29L

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
Meta Mutation Damage Score 0.1351 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Zfp518b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfp518b APN 5 38673766 missense possibly damaging 0.58
IGL01096:Zfp518b APN 5 38672788 missense probably benign 0.01
IGL02150:Zfp518b APN 5 38673343 missense probably damaging 1.00
IGL02150:Zfp518b APN 5 38673789 missense probably damaging 1.00
IGL02491:Zfp518b APN 5 38673780 missense possibly damaging 0.90
IGL02643:Zfp518b APN 5 38674155 missense probably damaging 1.00
IGL02710:Zfp518b APN 5 38672718 missense probably damaging 1.00
R0134:Zfp518b UTSW 5 38674659 start codon destroyed probably null 0.92
R0284:Zfp518b UTSW 5 38671740 missense probably damaging 1.00
R0308:Zfp518b UTSW 5 38672770 missense possibly damaging 0.64
R0613:Zfp518b UTSW 5 38673603 missense probably damaging 1.00
R1604:Zfp518b UTSW 5 38673606 missense probably damaging 1.00
R1649:Zfp518b UTSW 5 38671881 missense probably damaging 1.00
R1845:Zfp518b UTSW 5 38671741 missense probably damaging 0.97
R1853:Zfp518b UTSW 5 38673407 missense probably benign 0.00
R2015:Zfp518b UTSW 5 38672002 missense probably benign 0.00
R2256:Zfp518b UTSW 5 38671636 missense possibly damaging 0.90
R3687:Zfp518b UTSW 5 38674112 missense probably damaging 1.00
R4275:Zfp518b UTSW 5 38671728 missense probably damaging 1.00
R4600:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4603:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4739:Zfp518b UTSW 5 38674498 missense possibly damaging 0.89
R5519:Zfp518b UTSW 5 38674098 missense probably damaging 1.00
R6827:Zfp518b UTSW 5 38671539 missense probably damaging 1.00
R6982:Zfp518b UTSW 5 38672905 missense probably benign 0.00
R7263:Zfp518b UTSW 5 38672328 missense probably damaging 1.00
R7271:Zfp518b UTSW 5 38674564 missense probably benign 0.01
R7354:Zfp518b UTSW 5 38682779 start gained probably benign
R7554:Zfp518b UTSW 5 38673072 missense probably damaging 1.00
R7738:Zfp518b UTSW 5 38672187 missense probably benign 0.20
R7817:Zfp518b UTSW 5 38672398 missense not run
Z1088:Zfp518b UTSW 5 38674293 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGCCTGGCTTGAAGTTCCTAACC -3'
(R):5'- TTTACCACGAAGTGCCTGCTGC -3'

Sequencing Primer
(F):5'- AGCAGACATAAGTGTCTTGGCTC -3'
(R):5'- CTCCACCAGTCACTGGATGTG -3'
Posted On2013-05-09