Incidental Mutation 'R4803:Rps6kb2'
ID370515
Institutional Source Beutler Lab
Gene Symbol Rps6kb2
Ensembl Gene ENSMUSG00000024830
Gene Nameribosomal protein S6 kinase, polypeptide 2
SynonymsS6K2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4803 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4156713-4163354 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4158678 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 280 (K280*)
Ref Sequence ENSEMBL: ENSMUSP00000112512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008893] [ENSMUST00000025749] [ENSMUST00000061086] [ENSMUST00000118483] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431]
Predicted Effect probably benign
Transcript: ENSMUST00000008893
SMART Domains Protein: ENSMUSP00000008893
Gene: ENSMUSG00000024835

DomainStartEndE-ValueType
DUF1899 5 69 1.48e-37 SMART
WD40 68 111 2.1e-7 SMART
WD40 121 161 1.44e-5 SMART
WD40 164 204 4.08e-5 SMART
DUF1900 258 392 6.41e-88 SMART
coiled coil region 445 482 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000025749
AA Change: K280*
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830
AA Change: K280*

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061086
SMART Domains Protein: ENSMUSP00000053412
Gene: ENSMUSG00000045826

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Pfam:PTPRCAP 58 197 8.1e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118483
AA Change: K280*
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830
AA Change: K280*

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125057
Predicted Effect silent
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155303
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains a kinase catalytic domain and phosphorylates the S6 ribosomal protein and eukaryotic translation initiation factor 4B (eIF4B). Phosphorylation of S6 leads to an increase in protein synthesis and cell proliferation. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Anxa8 T A 14: 34,092,622 probably null Het
Ap4e1 A G 2: 127,049,559 I83M probably benign Het
Arhgap44 G C 11: 65,053,095 P197A probably benign Het
Asb1 T A 1: 91,552,329 V157E probably damaging Het
B3gat1 T A 9: 26,755,690 Y73N probably benign Het
Bmp8a G A 4: 123,324,569 T219I possibly damaging Het
Cacna1c G A 6: 118,751,541 S285F probably damaging Het
Cd163 A G 6: 124,312,430 D369G probably damaging Het
Ckap2l C T 2: 129,269,256 G674R probably damaging Het
Cog2 A G 8: 124,535,451 Y276C probably damaging Het
Col16a1 A T 4: 130,055,108 probably benign Het
Col5a1 G A 2: 28,011,341 G1282R unknown Het
Cyp2c29 A T 19: 39,324,995 M351L probably benign Het
Cyp4f15 T A 17: 32,692,580 D145E probably benign Het
Defb48 T C 14: 62,984,457 Y4C unknown Het
Dnaaf3 T C 7: 4,526,904 Q292R probably benign Het
Dnah11 T C 12: 118,127,608 M930V possibly damaging Het
Dnaja2 A T 8: 85,553,400 I50K probably damaging Het
Dnm2 A G 9: 21,474,629 N316S probably damaging Het
Dusp12 A G 1: 170,880,606 Y181H possibly damaging Het
Efemp1 T G 11: 28,921,795 F437V possibly damaging Het
Eps8l3 T A 3: 107,891,009 V464D probably damaging Het
Fat2 A T 11: 55,285,060 L1609Q probably benign Het
Fbxw24 C T 9: 109,624,842 V79I probably benign Het
Fgl2 A T 5: 21,375,920 Q420L probably benign Het
Filip1 T C 9: 79,820,114 K408E probably benign Het
Fkbp9 A C 6: 56,875,707 I471L probably benign Het
Fndc1 A T 17: 7,753,706 S1465T probably damaging Het
Fry A T 5: 150,399,533 T1050S probably benign Het
Gm12258 G A 11: 58,859,030 V344I probably benign Het
Gm5434 T A 12: 36,090,730 probably benign Het
Gtf3c1 A G 7: 125,663,540 V1049A probably damaging Het
Ireb2 A G 9: 54,906,814 E829G probably benign Het
Itih5 G A 2: 10,240,581 V494I probably benign Het
Krt75 A T 15: 101,568,072 D419E probably benign Het
Lama1 T C 17: 67,809,271 S2378P probably damaging Het
Lcorl T A 5: 45,747,281 probably null Het
Man2a1 A T 17: 64,659,009 H314L probably damaging Het
Mthfd1l T A 10: 4,007,840 H292Q possibly damaging Het
Ocm A T 5: 144,023,868 M87K possibly damaging Het
Olfr1193 A T 2: 88,678,022 S56C probably benign Het
Olfr1451 T C 19: 12,999,169 L61P probably damaging Het
Olfr482 A C 7: 108,095,459 I37S probably damaging Het
Olfr677 A C 7: 105,056,656 I137L probably benign Het
Olfr891 C A 9: 38,180,250 S191I probably damaging Het
Olfr951 A G 9: 39,394,636 T282A probably benign Het
Oplah A G 15: 76,302,768 Y616H probably damaging Het
Pde3a G A 6: 141,459,086 V346M probably damaging Het
Pdlim1 T A 19: 40,243,448 E162V possibly damaging Het
Pdzd2 C G 15: 12,374,595 S1818T probably benign Het
Phf24 G A 4: 42,933,731 G38S probably damaging Het
Plekhg1 T C 10: 3,957,186 V701A probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ptprz1 A G 6: 23,001,546 S1212G probably benign Het
Rab3il1 C A 19: 10,027,444 Q110K possibly damaging Het
Rin3 A T 12: 102,361,383 probably benign Het
Slc27a6 G T 18: 58,572,033 L162F possibly damaging Het
Slc6a19 T A 13: 73,684,042 I472F possibly damaging Het
Spatc1l G A 10: 76,569,372 R196Q probably damaging Het
Srp72 T C 5: 76,984,384 I273T probably damaging Het
St8sia1 C A 6: 142,867,923 S171I probably benign Het
Tas2r136 T C 6: 132,777,492 H224R probably damaging Het
Tas2r140 A G 6: 133,055,780 V5A possibly damaging Het
Tbce C T 13: 14,019,861 R71H probably damaging Het
Tdrd9 A T 12: 111,996,835 K115* probably null Het
Thada T A 17: 84,272,817 H1403L probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Timm44 A G 8: 4,267,932 S159P probably damaging Het
Tlk2 T A 11: 105,281,100 C699S probably damaging Het
Tmem178b A G 6: 40,004,226 K65R probably damaging Het
Ttc28 T C 5: 111,277,463 V1718A possibly damaging Het
Ttc6 T G 12: 57,728,505 C1662W probably damaging Het
Unc13a C A 8: 71,662,850 probably null Het
Vip A T 10: 5,644,099 I151F probably damaging Het
Vps16 C T 2: 130,438,110 P85L probably benign Het
Wdsub1 T C 2: 59,870,399 probably benign Het
Zc3h12c T C 9: 52,116,553 D503G probably damaging Het
Other mutations in Rps6kb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Rps6kb2 APN 19 4157588 missense probably damaging 1.00
R0735:Rps6kb2 UTSW 19 4157883 missense probably benign 0.00
R2034:Rps6kb2 UTSW 19 4161107 missense probably damaging 1.00
R4909:Rps6kb2 UTSW 19 4157003 utr 3 prime probably benign
R5070:Rps6kb2 UTSW 19 4163228 missense probably damaging 1.00
R5635:Rps6kb2 UTSW 19 4161134 missense probably damaging 1.00
R6080:Rps6kb2 UTSW 19 4158672 missense probably benign 0.22
R6284:Rps6kb2 UTSW 19 4161187 missense probably benign 0.17
R6600:Rps6kb2 UTSW 19 4158851 missense probably damaging 1.00
R7649:Rps6kb2 UTSW 19 4157021 missense unknown
R8248:Rps6kb2 UTSW 19 4156988 splice site probably benign
R8261:Rps6kb2 UTSW 19 4161196 missense possibly damaging 0.85
R8532:Rps6kb2 UTSW 19 4159244 missense probably damaging 1.00
R8807:Rps6kb2 UTSW 19 4163230 missense probably damaging 1.00
R8838:Rps6kb2 UTSW 19 4161184 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCAATGTGTCTGCCATCC -3'
(R):5'- TGTACGACATGCTCACTGGATC -3'

Sequencing Primer
(F):5'- AATGTGTCTGCCATCCCCAGAG -3'
(R):5'- ATGCTCACTGGATCGGCAAGTC -3'
Posted On2016-02-04