Incidental Mutation 'R4804:Olfr988'
ID370525
Institutional Source Beutler Lab
Gene Symbol Olfr988
Ensembl Gene ENSMUSG00000075222
Gene Nameolfactory receptor 988
SynonymsGA_x6K02T2Q125-46830591-46829662, MOR203-5P
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85352428-85363227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85353081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 282 (I282V)
Ref Sequence ENSEMBL: ENSMUSP00000151211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099928] [ENSMUST00000111597] [ENSMUST00000215511]
Predicted Effect probably benign
Transcript: ENSMUST00000099928
AA Change: I282V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097512
Gene: ENSMUSG00000075222
AA Change: I282V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 3.8e-31 PFAM
Pfam:7tm_4 139 283 3.7e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111597
AA Change: I282V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107224
Gene: ENSMUSG00000075222
AA Change: I282V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.1e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 7.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215511
AA Change: I282V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Olfr988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Olfr988 APN 2 85353662 missense probably benign 0.01
IGL02651:Olfr988 APN 2 85353050 missense probably damaging 1.00
R0505:Olfr988 UTSW 2 85353749 missense possibly damaging 0.87
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1632:Olfr988 UTSW 2 85353242 missense possibly damaging 0.78
R2187:Olfr988 UTSW 2 85353915 missense probably benign
R2251:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2252:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2253:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R3522:Olfr988 UTSW 2 85353003 missense probably benign 0.06
R4855:Olfr988 UTSW 2 85353449 missense possibly damaging 0.89
R4895:Olfr988 UTSW 2 85352997 makesense probably null
R4918:Olfr988 UTSW 2 85353288 missense probably benign 0.39
R5171:Olfr988 UTSW 2 85353770 missense probably benign 0.11
R5208:Olfr988 UTSW 2 85353798 missense probably benign 0.07
R5938:Olfr988 UTSW 2 85353276 missense probably damaging 1.00
R6088:Olfr988 UTSW 2 85353354 missense probably damaging 0.99
R7213:Olfr988 UTSW 2 85353556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCCATTCAATATGTGCCTTG -3'
(R):5'- ACCTAGTGAGCACTGTACTTG -3'

Sequencing Primer
(F):5'- GCCATTCAATATGTGCCTTGATATC -3'
(R):5'- ACCTAGTGAGCACTGTACTTGTTGTC -3'
Posted On2016-02-04