Incidental Mutation 'R4804:Cds1'
ID370535
Institutional Source Beutler Lab
Gene Symbol Cds1
Ensembl Gene ENSMUSG00000029330
Gene NameCDP-diacylglycerol synthase 1
Synonyms4833409J18Rik, phosphatidate cytidylyltransferase
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location101765130-101823858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101821523 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 449 (L449P)
Ref Sequence ENSEMBL: ENSMUSP00000031273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031273]
Predicted Effect probably damaging
Transcript: ENSMUST00000031273
AA Change: L449P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031273
Gene: ENSMUSG00000029330
AA Change: L449P

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:CTP_transf_1 87 417 6.4e-89 PFAM
low complexity region 427 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132213
Meta Mutation Damage Score 0.9407 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Cds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cds1 APN 5 101809901 missense probably damaging 0.99
IGL02052:Cds1 APN 5 101814472 missense probably benign 0.01
IGL02238:Cds1 APN 5 101814436 missense possibly damaging 0.84
IGL02449:Cds1 APN 5 101815928 missense probably damaging 1.00
IGL02833:Cds1 APN 5 101814466 missense possibly damaging 0.81
IGL02973:Cds1 APN 5 101812510 missense probably damaging 0.99
IGL02987:Cds1 APN 5 101812525 missense possibly damaging 0.85
R0076:Cds1 UTSW 5 101817840 splice site probably benign
R0200:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0285:Cds1 UTSW 5 101797038 missense probably damaging 1.00
R0608:Cds1 UTSW 5 101814433 missense probably damaging 0.97
R0932:Cds1 UTSW 5 101797025 missense probably damaging 0.99
R1444:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R1585:Cds1 UTSW 5 101817962 splice site probably benign
R1781:Cds1 UTSW 5 101812550 missense possibly damaging 0.78
R2126:Cds1 UTSW 5 101812550 missense probably benign 0.34
R4990:Cds1 UTSW 5 101798379 missense probably damaging 1.00
R5176:Cds1 UTSW 5 101781420 missense possibly damaging 0.87
R5330:Cds1 UTSW 5 101798495 missense probably damaging 1.00
R5331:Cds1 UTSW 5 101798495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTGCTCACTGTGCAAAC -3'
(R):5'- GACTGCTGCACTCACCTTAG -3'

Sequencing Primer
(F):5'- CTCACTGTGCAAACGGTGTG -3'
(R):5'- TGCACTCACCTTAGACCACGTG -3'
Posted On2016-02-04