Incidental Mutation 'R4804:Tbx3'
ID370536
Institutional Source Beutler Lab
Gene Symbol Tbx3
Ensembl Gene ENSMUSG00000018604
Gene NameT-box 3
SynonymsD5Ertd189e
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4804 (G1)
Quality Score144
Status Validated
Chromosome5
Chromosomal Location119670669-119684724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119680512 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 384 (D384G)
Ref Sequence ENSEMBL: ENSMUSP00000112519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018748
AA Change: D404G

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: D404G

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 310 6.4e-125 SMART
Pfam:TBX 323 411 8.8e-29 PFAM
low complexity region 492 510 N/A INTRINSIC
low complexity region 524 538 N/A INTRINSIC
low complexity region 556 576 N/A INTRINSIC
low complexity region 607 620 N/A INTRINSIC
low complexity region 662 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079719
AA Change: D384G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: D384G

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121021
AA Change: D384G

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: D384G

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154680
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Tbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Tbx3 APN 5 119682643 missense probably benign 0.45
IGL02174:Tbx3 APN 5 119675584 nonsense probably null
IGL02508:Tbx3 APN 5 119678812 missense possibly damaging 0.48
IGL03035:Tbx3 APN 5 119683096 utr 3 prime probably benign
R0047:Tbx3 UTSW 5 119680446 missense probably damaging 0.99
R0184:Tbx3 UTSW 5 119675562 missense probably damaging 1.00
R0365:Tbx3 UTSW 5 119675250 missense possibly damaging 0.81
R1209:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R1956:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R2231:Tbx3 UTSW 5 119677524 missense probably damaging 1.00
R4093:Tbx3 UTSW 5 119680748 missense probably benign
R4400:Tbx3 UTSW 5 119680571 missense probably damaging 0.99
R4578:Tbx3 UTSW 5 119682776 missense probably damaging 0.99
R4693:Tbx3 UTSW 5 119677570 missense possibly damaging 0.72
R4716:Tbx3 UTSW 5 119675670 missense possibly damaging 0.94
R5664:Tbx3 UTSW 5 119678731 missense possibly damaging 0.48
R5724:Tbx3 UTSW 5 119675603 missense possibly damaging 0.75
R5990:Tbx3 UTSW 5 119680529 missense probably benign 0.02
R6133:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R6180:Tbx3 UTSW 5 119674067 missense probably damaging 1.00
R6429:Tbx3 UTSW 5 119674191 nonsense probably null
R7154:Tbx3 UTSW 5 119672028 missense possibly damaging 0.89
R7195:Tbx3 UTSW 5 119675583 missense probably damaging 1.00
R7352:Tbx3 UTSW 5 119677560 missense probably benign 0.00
R8050:Tbx3 UTSW 5 119683067 missense probably benign 0.38
R8089:Tbx3 UTSW 5 119680569 missense probably damaging 0.98
X0063:Tbx3 UTSW 5 119680881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTGGAAACGAGATTGACC -3'
(R):5'- TGCCCGTTGAAGAACTGCTG -3'

Sequencing Primer
(F):5'- AACGAGATTGACCATCCGTTTC -3'
(R):5'- TTGAAGAACTGCTGGCCCG -3'
Posted On2016-02-04