Incidental Mutation 'R4804:Rilpl1'
ID370537
Institutional Source Beutler Lab
Gene Symbol Rilpl1
Ensembl Gene ENSMUSG00000029392
Gene NameRab interacting lysosomal protein-like 1
Synonyms2900002H16Rik, 6330559I19Rik, GOSPEL
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124493080-124531391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124493765 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 173 (W173R)
Ref Sequence ENSEMBL: ENSMUSP00000143250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031349] [ENSMUST00000062153] [ENSMUST00000111453] [ENSMUST00000136567] [ENSMUST00000199125] [ENSMUST00000199766]
Predicted Effect probably benign
Transcript: ENSMUST00000031349
SMART Domains Protein: ENSMUSP00000031349
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 125 7.24e-21 SMART
low complexity region 132 146 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 224 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062153
AA Change: W386R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050014
Gene: ENSMUSG00000029392
AA Change: W386R

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 27 175 2.3e-47 PFAM
Pfam:RILP 298 351 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111453
SMART Domains Protein: ENSMUSP00000107080
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 125 7.24e-21 SMART
low complexity region 132 146 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 224 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136567
SMART Domains Protein: ENSMUSP00000121120
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 121 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199125
SMART Domains Protein: ENSMUSP00000142887
Gene: ENSMUSG00000029392

DomainStartEndE-ValueType
coiled coil region 21 65 N/A INTRINSIC
Pfam:RILP 105 164 2.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199766
AA Change: W173R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143250
Gene: ENSMUSG00000029392
AA Change: W173R

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:RILP 77 136 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200202
Meta Mutation Damage Score 0.3833 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Rilpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Rilpl1 APN 5 124503649 missense probably damaging 1.00
IGL01727:Rilpl1 APN 5 124530944 missense possibly damaging 0.50
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0974:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0974:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R1056:Rilpl1 UTSW 5 124493837 missense probably damaging 1.00
R1539:Rilpl1 UTSW 5 124515555 missense probably damaging 1.00
R1800:Rilpl1 UTSW 5 124514656 missense probably damaging 1.00
R1928:Rilpl1 UTSW 5 124514750 unclassified probably benign
R4661:Rilpl1 UTSW 5 124514688 missense probably benign 0.32
R4904:Rilpl1 UTSW 5 124514744 unclassified probably null
R4937:Rilpl1 UTSW 5 124515531 missense possibly damaging 0.64
R5034:Rilpl1 UTSW 5 124493824 missense probably damaging 1.00
R6301:Rilpl1 UTSW 5 124514539 missense probably damaging 1.00
R7009:Rilpl1 UTSW 5 124503692 synonymous silent
R7681:Rilpl1 UTSW 5 124530913 missense possibly damaging 0.82
R7788:Rilpl1 UTSW 5 124496137 intron probably null
Predicted Primers PCR Primer
(F):5'- TAAACTGGGTAGCCCTGCAG -3'
(R):5'- AATGGATCTGCTCCTGTGTGC -3'

Sequencing Primer
(F):5'- TGGGTAGCCCTGCAGATAAATAAAAC -3'
(R):5'- GTGCTTGTTCCTGCGTGCC -3'
Posted On2016-02-04