Incidental Mutation 'R4804:Col26a1'
ID370539
Institutional Source Beutler Lab
Gene Symbol Col26a1
Ensembl Gene ENSMUSG00000004415
Gene Namecollagen, type XXVI, alpha 1
SynonymsCol26a1, Collagen XXVI, Emu2
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136741759-136883209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136836725 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000106732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057497] [ENSMUST00000111103]
Predicted Effect probably damaging
Transcript: ENSMUST00000057497
AA Change: V105A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052095
Gene: ENSMUSG00000004415
AA Change: V105A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 53 123 5.6e-21 PFAM
low complexity region 143 157 N/A INTRINSIC
Pfam:Collagen 189 252 2e-10 PFAM
Pfam:Collagen 217 273 8.4e-9 PFAM
low complexity region 302 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111103
AA Change: V103A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106732
Gene: ENSMUSG00000004415
AA Change: V103A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:EMI 52 123 1.2e-27 PFAM
low complexity region 141 155 N/A INTRINSIC
Pfam:Collagen 187 250 2.1e-10 PFAM
Pfam:Collagen 215 271 8.6e-9 PFAM
Pfam:Collagen 298 335 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196053
Meta Mutation Damage Score 0.2737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an emilin domain and two collagen stretches. This gene may be associated with aspirin-intolerant asthma. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Col26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02500:Col26a1 APN 5 136754339 nonsense probably null
IGL03028:Col26a1 APN 5 136743118 missense possibly damaging 0.78
IGL03144:Col26a1 APN 5 136765348 missense probably damaging 0.99
PIT4514001:Col26a1 UTSW 5 136751725 missense probably benign
R0454:Col26a1 UTSW 5 136754193 missense probably benign 0.01
R0833:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R0836:Col26a1 UTSW 5 136765300 critical splice donor site probably null
R1187:Col26a1 UTSW 5 136744166 missense probably damaging 0.99
R1236:Col26a1 UTSW 5 136754926 missense probably benign
R4646:Col26a1 UTSW 5 136847550 missense probably damaging 1.00
R5772:Col26a1 UTSW 5 136847566 nonsense probably null
R6026:Col26a1 UTSW 5 136847500 missense probably damaging 1.00
R6481:Col26a1 UTSW 5 136744178 missense probably benign 0.45
R6919:Col26a1 UTSW 5 136744234 missense possibly damaging 0.86
R7848:Col26a1 UTSW 5 136747053 missense possibly damaging 0.72
R7895:Col26a1 UTSW 5 136748177 intron probably null
R7911:Col26a1 UTSW 5 136743098 missense probably damaging 1.00
R7931:Col26a1 UTSW 5 136747053 missense possibly damaging 0.72
R7978:Col26a1 UTSW 5 136748177 intron probably null
R7992:Col26a1 UTSW 5 136743098 missense probably damaging 1.00
R8131:Col26a1 UTSW 5 136747040 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTCTCAAAGCACGTAGAGC -3'
(R):5'- AAGGACCCTGATTCCTGTCTGG -3'

Sequencing Primer
(F):5'- CACGTAGAGCAGAAAGGGAAC -3'
(R):5'- GGTGATTTGTCTCTAACCACAGAGC -3'
Posted On2016-02-04