Incidental Mutation 'R0421:Sbds'
ID37054
Institutional Source Beutler Lab
Gene Symbol Sbds
Ensembl Gene ENSMUSG00000025337
Gene NameSBDS ribosome maturation factor
SynonymsCGI-97, 4733401P19Rik
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0421 (G1)
Quality Score218
Status Validated
Chromosome5
Chromosomal Location130245731-130255530 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 130253933 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026387] [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000125625] [ENSMUST00000139211] [ENSMUST00000147619]
Predicted Effect probably benign
Transcript: ENSMUST00000026387
SMART Domains Protein: ENSMUSP00000026387
Gene: ENSMUSG00000025337

DomainStartEndE-ValueType
Pfam:SBDS 14 101 1.2e-36 PFAM
Pfam:SBDS_C 107 225 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040213
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044204
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100662
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125625
SMART Domains Protein: ENSMUSP00000115494
Gene: ENSMUSG00000025337

DomainStartEndE-ValueType
Pfam:SBDS 3 66 2.1e-25 PFAM
Pfam:SBDS_C 69 173 9.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139211
Predicted Effect probably benign
Transcript: ENSMUST00000147619
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201598
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a protein that is necessary for ribosome function and maintaining normal levels of protein synthesis. The encoded protein may function to activate ribosomes for translation, and may be involved in cellular response to stress and DNA damage. Loss of this gene is embryonic lethal while deficiency of the encoded protein in the pancreas is associated with symptoms of Shwachman-Diamond syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation and failure of gastrulation. Heterozygotes for the same allele are viable and fertile with no signs of Shwachman-Diamond syndrome related abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Sbds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Sbds APN 5 130254066 missense probably damaging 1.00
IGL02111:Sbds APN 5 130250941 missense probably damaging 1.00
R0546:Sbds UTSW 5 130254078 missense possibly damaging 0.93
R4693:Sbds UTSW 5 130250975 missense probably damaging 1.00
R5527:Sbds UTSW 5 130246406 missense possibly damaging 0.95
R6144:Sbds UTSW 5 130246344 missense probably benign
R8003:Sbds UTSW 5 130250885 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGATTCCGGTCCTAATCACTGCAT -3'
(R):5'- TCTCTCCTGCCCTTTCAAGGGAAAA -3'

Sequencing Primer
(F):5'- gaatcagaagttccatgccag -3'
(R):5'- AAAGACCTTGATGAAGTTCTGC -3'
Posted On2013-05-09