Incidental Mutation 'R4804:Cdk8'
ID370540
Institutional Source Beutler Lab
Gene Symbol Cdk8
Ensembl Gene ENSMUSG00000029635
Gene Namecyclin-dependent kinase 8
Synonyms
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146231230-146302874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146296399 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 236 (K236E)
Ref Sequence ENSEMBL: ENSMUSP00000125668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031640] [ENSMUST00000161181] [ENSMUST00000161652] [ENSMUST00000162494]
Predicted Effect probably damaging
Transcript: ENSMUST00000031640
AA Change: K301E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031640
Gene: ENSMUSG00000029635
AA Change: K301E

DomainStartEndE-ValueType
S_TKc 21 335 1.89e-83 SMART
low complexity region 372 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160924
Predicted Effect probably damaging
Transcript: ENSMUST00000161181
AA Change: K236E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125668
Gene: ENSMUSG00000029635
AA Change: K236E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 179 6e-16 PFAM
Pfam:Pkinase 1 270 1.6e-44 PFAM
low complexity region 307 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161652
SMART Domains Protein: ENSMUSP00000124323
Gene: ENSMUSG00000029635

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 22 215 2e-22 PFAM
Pfam:Pkinase 23 226 5.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162494
SMART Domains Protein: ENSMUSP00000125516
Gene: ENSMUSG00000029635

DomainStartEndE-ValueType
Pfam:Pkinase 22 153 5.9e-25 PFAM
Pfam:Pkinase_Tyr 22 156 1.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198861
Meta Mutation Damage Score 0.1585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele die prior to implantation exhibiting fragmented blastomeres and failure to undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Cdk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Cdk8 APN 5 146295163 unclassified probably null
R0506:Cdk8 UTSW 5 146298872 missense probably damaging 1.00
R1132:Cdk8 UTSW 5 146299815 missense probably benign 0.09
R1513:Cdk8 UTSW 5 146296378 missense possibly damaging 0.93
R2231:Cdk8 UTSW 5 146231604 start gained probably benign
R3692:Cdk8 UTSW 5 146283668 nonsense probably null
R4157:Cdk8 UTSW 5 146299449 intron probably benign
R4760:Cdk8 UTSW 5 146292666 missense probably benign 0.15
R5119:Cdk8 UTSW 5 146283627 critical splice acceptor site probably null
R6633:Cdk8 UTSW 5 146298846 nonsense probably null
R6755:Cdk8 UTSW 5 146268316 missense probably damaging 1.00
R7442:Cdk8 UTSW 5 146292769 critical splice donor site probably null
R8083:Cdk8 UTSW 5 146268290 missense probably damaging 1.00
Z1177:Cdk8 UTSW 5 146299795 missense probably damaging 0.96
Z1177:Cdk8 UTSW 5 146299796 missense probably damaging 0.99
Z1177:Cdk8 UTSW 5 146301637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTATTTTATGCTGCTCAGAG -3'
(R):5'- TCAGGGTGACTATCTAACGTGAAC -3'

Sequencing Primer
(F):5'- CTCAGAGCATAGTTGATGTGTAGC -3'
(R):5'- TGACTATCTAACGTGAACAAGGC -3'
Posted On2016-02-04