Incidental Mutation 'R4804:Slc25a13'
ID370542
Institutional Source Beutler Lab
Gene Symbol Slc25a13
Ensembl Gene ENSMUSG00000015112
Gene Namesolute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonymscitrin, Ctrn
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location6041218-6217173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6109213 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 383 (L383H)
Ref Sequence ENSEMBL: ENSMUSP00000139571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]
Predicted Effect probably damaging
Transcript: ENSMUST00000015256
AA Change: L383H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: L383H

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 5.2e-27 PFAM
Pfam:Mito_carr 425 516 1.2e-17 PFAM
Pfam:Mito_carr 517 612 1.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177698
AA Change: L329H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143688
Gene: ENSMUSG00000015112
AA Change: L329H

DomainStartEndE-ValueType
EFh 52 80 2.8e-1 SMART
EFh 86 114 3.1e-3 SMART
Pfam:Mito_carr 273 339 3.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188414
AA Change: L383H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: L383H

DomainStartEndE-ValueType
EFh 57 85 5.75e1 SMART
EFh 91 119 6.14e-1 SMART
EFh 162 190 7.87e1 SMART
Pfam:Mito_carr 327 424 2.6e-26 PFAM
Pfam:Mito_carr 425 516 4.4e-19 PFAM
Pfam:Mito_carr 517 612 1.4e-29 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Slc25a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Slc25a13 APN 6 6042739 critical splice donor site probably null
IGL02237:Slc25a13 APN 6 6042646 missense probably damaging 1.00
IGL02285:Slc25a13 APN 6 6042643 missense possibly damaging 0.95
IGL02287:Slc25a13 APN 6 6216992 splice site probably benign
IGL02593:Slc25a13 APN 6 6042265 missense probably benign 0.00
R0028:Slc25a13 UTSW 6 6181047 missense probably benign 0.10
R0045:Slc25a13 UTSW 6 6109277 missense probably benign 0.05
R0384:Slc25a13 UTSW 6 6042600 nonsense probably null
R0711:Slc25a13 UTSW 6 6117128 missense probably damaging 0.99
R1299:Slc25a13 UTSW 6 6113937 critical splice donor site probably null
R1625:Slc25a13 UTSW 6 6096675 missense probably damaging 1.00
R1701:Slc25a13 UTSW 6 6152525 critical splice acceptor site probably null
R1792:Slc25a13 UTSW 6 6115104 missense possibly damaging 0.79
R1932:Slc25a13 UTSW 6 6042264 missense probably benign 0.33
R1933:Slc25a13 UTSW 6 6109262 missense probably damaging 1.00
R1952:Slc25a13 UTSW 6 6152482 missense probably damaging 1.00
R1969:Slc25a13 UTSW 6 6096668 critical splice donor site probably null
R2027:Slc25a13 UTSW 6 6073487 missense probably damaging 1.00
R2074:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2432:Slc25a13 UTSW 6 6114017 missense probably benign 0.21
R2508:Slc25a13 UTSW 6 6117190 missense probably benign 0.06
R3774:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R3775:Slc25a13 UTSW 6 6109288 missense probably damaging 1.00
R4816:Slc25a13 UTSW 6 6114274 missense possibly damaging 0.71
R4978:Slc25a13 UTSW 6 6042300 missense probably damaging 0.97
R6529:Slc25a13 UTSW 6 6073451 missense probably benign 0.39
R6615:Slc25a13 UTSW 6 6073454 missense probably damaging 1.00
R6709:Slc25a13 UTSW 6 6073440 missense possibly damaging 0.88
R7346:Slc25a13 UTSW 6 6181100 missense possibly damaging 0.67
R7571:Slc25a13 UTSW 6 6052785 missense probably damaging 1.00
R7807:Slc25a13 UTSW 6 6117164 missense probably damaging 0.99
R7852:Slc25a13 UTSW 6 6152461 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGGAGTGGAATACTTTAACAACAC -3'
(R):5'- AATTACCTTACTTCTGGCTGAGC -3'

Sequencing Primer
(F):5'- GATTAGCCATGCCCTAGATGC -3'
(R):5'- CTGGCTGAGCTACTGGTATCC -3'
Posted On2016-02-04