Incidental Mutation 'R4804:Ddx39'
ID370548
Institutional Source Beutler Lab
Gene Symbol Ddx39
Ensembl Gene ENSMUSG00000005481
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms2610307C23Rik, BAT1
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4804 (G1)
Quality Score202
Status Validated
Chromosome8
Chromosomal Location83715177-83726892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83721095 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 190 (K190E)
Ref Sequence ENSEMBL: ENSMUSP00000148329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000019576
AA Change: K190E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481
AA Change: K190E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109810
AA Change: K190E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481
AA Change: K190E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect possibly damaging
Transcript: ENSMUST00000140521
AA Change: K190E

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481
AA Change: K190E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140606
Predicted Effect probably benign
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172396
AA Change: K190E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481
AA Change: K190E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184114
Predicted Effect probably damaging
Transcript: ENSMUST00000212949
AA Change: K190E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.5778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Ddx39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39 APN 8 83722773 missense probably benign 0.03
IGL02712:Ddx39 APN 8 83721757 missense probably benign 0.03
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0143:Ddx39 UTSW 8 83720550 missense probably benign 0.22
R0147:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0148:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0392:Ddx39 UTSW 8 83721737 missense probably damaging 0.97
R0426:Ddx39 UTSW 8 83721769 missense probably benign 0.00
R0830:Ddx39 UTSW 8 83719823 missense possibly damaging 0.47
R1509:Ddx39 UTSW 8 83719898 missense probably damaging 1.00
R2935:Ddx39 UTSW 8 83720958 missense possibly damaging 0.57
R3082:Ddx39 UTSW 8 83722706 missense possibly damaging 0.57
R4050:Ddx39 UTSW 8 83722234 missense probably benign 0.00
R4647:Ddx39 UTSW 8 83722273 missense probably benign 0.00
R5242:Ddx39 UTSW 8 83721811 missense probably benign 0.01
R5268:Ddx39 UTSW 8 83722321 missense probably benign 0.08
R6598:Ddx39 UTSW 8 83722927 missense probably benign 0.03
R6805:Ddx39 UTSW 8 83723137 missense probably damaging 1.00
R6852:Ddx39 UTSW 8 83723017 missense probably benign 0.03
R7326:Ddx39 UTSW 8 83722471 missense probably benign 0.31
R7559:Ddx39 UTSW 8 83720966 missense possibly damaging 0.82
R7803:Ddx39 UTSW 8 83719600 critical splice donor site probably null
R8103:Ddx39 UTSW 8 83724476 critical splice acceptor site probably null
X0026:Ddx39 UTSW 8 83722330 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGCTGTAAGGATCACTGCC -3'
(R):5'- ACCTCAGAATTCCCCTTAGGC -3'

Sequencing Primer
(F):5'- GTAAGGATCACTGCCCCCAGATG -3'
(R):5'- TAGGCTTCTCCTAGAAACCCTGAG -3'
Posted On2016-02-04