Incidental Mutation 'R4804:Pcnx4'
ID370564
Institutional Source Beutler Lab
Gene Symbol Pcnx4
Ensembl Gene ENSMUSG00000034501
Gene Namepecanex homolog 4
Synonyms1810048J11Rik, Pcnxl4
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72536383-72580119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72574202 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 932 (I932T)
Ref Sequence ENSEMBL: ENSMUSP00000038916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044352]
Predicted Effect probably benign
Transcript: ENSMUST00000044352
AA Change: I932T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038916
Gene: ENSMUSG00000034501
AA Change: I932T

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 247 264 N/A INTRINSIC
transmembrane domain 296 330 N/A INTRINSIC
transmembrane domain 368 390 N/A INTRINSIC
transmembrane domain 400 417 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
transmembrane domain 546 564 N/A INTRINSIC
transmembrane domain 577 599 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Pfam:Pecanex_C 999 1174 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222413
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Pcnx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pcnx4 APN 12 72579365 missense probably damaging 0.97
IGL01160:Pcnx4 APN 12 72579377 missense probably damaging 1.00
IGL01385:Pcnx4 APN 12 72573746 missense probably damaging 1.00
IGL01452:Pcnx4 APN 12 72574400 missense possibly damaging 0.79
IGL01984:Pcnx4 APN 12 72574409 missense probably benign 0.25
IGL02073:Pcnx4 APN 12 72574328 missense possibly damaging 0.92
IGL02726:Pcnx4 APN 12 72574212 missense probably benign 0.12
IGL02824:Pcnx4 APN 12 72555571 missense probably benign 0.02
R0007:Pcnx4 UTSW 12 72555579 missense possibly damaging 0.79
R0158:Pcnx4 UTSW 12 72556302 missense probably benign
R0575:Pcnx4 UTSW 12 72567236 missense probably benign 0.00
R0783:Pcnx4 UTSW 12 72575478 missense probably damaging 1.00
R1420:Pcnx4 UTSW 12 72555986 missense probably benign
R1497:Pcnx4 UTSW 12 72574400 missense probably benign 0.03
R2093:Pcnx4 UTSW 12 72579442 missense probably damaging 1.00
R2241:Pcnx4 UTSW 12 72574154 missense probably damaging 0.99
R2287:Pcnx4 UTSW 12 72575398 missense probably benign 0.05
R2418:Pcnx4 UTSW 12 72556263 missense probably damaging 1.00
R2437:Pcnx4 UTSW 12 72541813 missense probably damaging 1.00
R2509:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2510:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2512:Pcnx4 UTSW 12 72556799 critical splice acceptor site probably null
R3691:Pcnx4 UTSW 12 72573719 missense probably damaging 1.00
R3760:Pcnx4 UTSW 12 72567006 missense probably damaging 1.00
R3949:Pcnx4 UTSW 12 72556302 missense probably benign
R4065:Pcnx4 UTSW 12 72556360 critical splice donor site probably null
R4757:Pcnx4 UTSW 12 72556293 missense probably benign 0.00
R4867:Pcnx4 UTSW 12 72573952 missense probably benign 0.01
R4879:Pcnx4 UTSW 12 72567185 missense probably damaging 1.00
R5108:Pcnx4 UTSW 12 72574081 missense probably benign 0.01
R5350:Pcnx4 UTSW 12 72579364 missense probably damaging 1.00
R5504:Pcnx4 UTSW 12 72574448 missense probably damaging 1.00
R5718:Pcnx4 UTSW 12 72567194 missense possibly damaging 0.49
R5943:Pcnx4 UTSW 12 72579458 missense probably damaging 0.99
R6195:Pcnx4 UTSW 12 72556874 missense possibly damaging 0.92
R7134:Pcnx4 UTSW 12 72566976 missense probably damaging 0.96
R7695:Pcnx4 UTSW 12 72541576 missense probably benign 0.00
R7837:Pcnx4 UTSW 12 72556118 missense probably damaging 1.00
R7850:Pcnx4 UTSW 12 72556068 missense probably benign
R7920:Pcnx4 UTSW 12 72556118 missense probably damaging 1.00
R7933:Pcnx4 UTSW 12 72556068 missense probably benign
R8153:Pcnx4 UTSW 12 72556243 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACCATTCTGCAGGCACAG -3'
(R):5'- ACTCTTACTAGCTGACCAGGGC -3'

Sequencing Primer
(F):5'- GGTCCCAAAAATGATCTTTACAGGAC -3'
(R):5'- AGGGCTAGGCACTCCATTGTC -3'
Posted On2016-02-04