Incidental Mutation 'R4804:Hecw1'
ID370566
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14305985 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 499 (S499P)
Ref Sequence ENSEMBL: ENSMUSP00000152215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
Predicted Effect probably benign
Transcript: ENSMUST00000110516
AA Change: S926P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: S926P

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220718
AA Change: S499P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222241
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
BB011:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
R7924:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
R8252:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCTGAGATTCCTGCTGGGAG -3'
(R):5'- CACTTCTGATTCCAACACAGTG -3'

Sequencing Primer
(F):5'- GGAGGCTTCGCTATCCCCTTAAC -3'
(R):5'- TCTGATTCCAACACAGTGTTTTAC -3'
Posted On2016-02-04