Incidental Mutation 'R4804:Ipo4'
ID370573
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 55630856 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 495 (R495G)
Ref Sequence ENSEMBL: ENSMUSP00000123692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047131] [ENSMUST00000125133] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047131
AA Change: R495G

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319
AA Change: R495G

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127773
Predicted Effect possibly damaging
Transcript: ENSMUST00000135221
AA Change: R495G

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319
AA Change: R495G

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228754
Meta Mutation Damage Score 0.3529 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1167:Ipo4 UTSW 14 55635020 missense probably damaging 1.00
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R1804:Ipo4 UTSW 14 55629456 missense probably damaging 1.00
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4561:Ipo4 UTSW 14 55630089 splice site probably benign
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6018:Ipo4 UTSW 14 55626152 critical splice donor site probably null
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
R7344:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7345:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7702:Ipo4 UTSW 14 55632330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTCCCGGAGAAGATCC -3'
(R):5'- GCATCTTCCTGAGTTGCTCG -3'

Sequencing Primer
(F):5'- TCCATGATGGTAGGGAAGTAGG -3'
(R):5'- CTGCCTGCTGGGAATGAG -3'
Posted On2016-02-04