Incidental Mutation 'R0421:Olfr655'
ID37058
Institutional Source Beutler Lab
Gene Symbol Olfr655
Ensembl Gene ENSMUSG00000051182
Gene Nameolfactory receptor 655
SynonymsMOR38-1, GA_x6K02T2PBJ9-7224628-7223702
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104595301-104601779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104596722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 153 (V153A)
Ref Sequence ENSEMBL: ENSMUSP00000150891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057385] [ENSMUST00000215538] [ENSMUST00000216750]
Predicted Effect probably benign
Transcript: ENSMUST00000057385
AA Change: V153A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054108
Gene: ENSMUSG00000051182
AA Change: V153A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-95 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5e-10 PFAM
Pfam:7tm_1 41 291 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215434
Predicted Effect probably benign
Transcript: ENSMUST00000215538
AA Change: V153A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216750
AA Change: V153A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Olfr655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Olfr655 APN 7 104596534 missense probably damaging 1.00
IGL03309:Olfr655 APN 7 104597041 missense probably benign
R1966:Olfr655 UTSW 7 104596801 missense probably damaging 1.00
R4452:Olfr655 UTSW 7 104596639 missense probably damaging 0.98
R4566:Olfr655 UTSW 7 104596616 nonsense probably null
R5445:Olfr655 UTSW 7 104596821 missense probably damaging 1.00
R5494:Olfr655 UTSW 7 104596725 missense probably damaging 0.97
R5838:Olfr655 UTSW 7 104596897 missense probably benign
R6015:Olfr655 UTSW 7 104596708 missense probably damaging 1.00
R6928:Olfr655 UTSW 7 104596589 nonsense probably null
R6996:Olfr655 UTSW 7 104596811 missense probably benign 0.10
R7250:Olfr655 UTSW 7 104596531 missense probably damaging 1.00
R7268:Olfr655 UTSW 7 104597077 missense probably benign
X0027:Olfr655 UTSW 7 104597088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTGAGGCGTACCACACTCTG -3'
(R):5'- CACACCAATGTATCTGCTCCTGGC -3'

Sequencing Primer
(F):5'- AATTAGAAGCAGATCGAGTCCC -3'
(R):5'- GATCGAGTCATAGCCATCTATGC -3'
Posted On2013-05-09