Incidental Mutation 'R4804:Grik1'
ID370584
Institutional Source Beutler Lab
Gene Symbol Grik1
Ensembl Gene ENSMUSG00000022935
Gene Nameglutamate receptor, ionotropic, kainate 1
SynonymsGlurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87895900-88290265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87957569 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 376 (I376T)
Ref Sequence ENSEMBL: ENSMUSP00000147948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]
Predicted Effect probably damaging
Transcript: ENSMUST00000023652
AA Change: I376T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: I376T

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 4.7e-69 PFAM
Pfam:Peripla_BP_6 48 347 5.1e-11 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 815 2e-16 BLAST
low complexity region 829 850 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072256
AA Change: I376T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: I376T

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 2.6e-72 PFAM
Pfam:Peripla_BP_6 49 347 3.4e-10 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 817 1e-17 BLAST
low complexity region 858 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114137
AA Change: I305T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: I305T

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 325 5.4e-63 PFAM
Pfam:Peripla_BP_6 18 315 5.1e-11 PFAM
PBPe 362 730 2.4e-130 SMART
Lig_chan-Glu_bd 372 436 6.34e-31 SMART
Blast:PBPe 738 783 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210910
Predicted Effect probably damaging
Transcript: ENSMUST00000211444
AA Change: I376T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226447
Predicted Effect probably damaging
Transcript: ENSMUST00000227986
AA Change: I376T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228034
AA Change: I376T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228188
AA Change: I376T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.7698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cd226 T C 18: 89,207,168 V63A possibly damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Grik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Grik1 APN 16 87957600 splice site probably null
IGL01347:Grik1 APN 16 87957593 missense probably benign 0.00
IGL01612:Grik1 APN 16 87946735 missense probably damaging 1.00
IGL02010:Grik1 APN 16 88051508 missense possibly damaging 0.96
IGL02059:Grik1 APN 16 88056049 missense possibly damaging 0.95
IGL02068:Grik1 APN 16 87940651 missense possibly damaging 0.80
IGL02200:Grik1 APN 16 87940565 missense probably damaging 1.00
IGL02206:Grik1 APN 16 87935920 missense probably damaging 1.00
IGL02375:Grik1 APN 16 87946556 missense probably damaging 1.00
IGL02598:Grik1 APN 16 87947984 missense probably damaging 1.00
IGL02686:Grik1 APN 16 88009761 splice site probably null
IGL02890:Grik1 APN 16 87896802 intron probably benign
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0387:Grik1 UTSW 16 88034350 splice site probably benign
R0613:Grik1 UTSW 16 88051333 critical splice donor site probably null
R1087:Grik1 UTSW 16 88006377 missense probably benign 0.00
R1694:Grik1 UTSW 16 87950068 missense probably damaging 0.96
R1905:Grik1 UTSW 16 87896866 nonsense probably null
R1928:Grik1 UTSW 16 88051353 missense probably damaging 0.99
R2157:Grik1 UTSW 16 88056124 missense probably damaging 1.00
R3122:Grik1 UTSW 16 88006473 missense probably damaging 1.00
R3906:Grik1 UTSW 16 88006449 missense probably benign 0.00
R4194:Grik1 UTSW 16 87946728 missense probably benign 0.45
R4343:Grik1 UTSW 16 87896252 missense probably benign 0.00
R4349:Grik1 UTSW 16 87957543 missense probably damaging 1.00
R4416:Grik1 UTSW 16 88051461 missense probably benign 0.00
R4423:Grik1 UTSW 16 87923200 missense probably benign 0.10
R4660:Grik1 UTSW 16 87923131 missense probably damaging 1.00
R5052:Grik1 UTSW 16 87950098 missense probably benign 0.01
R5126:Grik1 UTSW 16 87947859 missense probably damaging 1.00
R5334:Grik1 UTSW 16 87923194 frame shift probably null
R5335:Grik1 UTSW 16 87923194 frame shift probably null
R5337:Grik1 UTSW 16 87923194 frame shift probably null
R5479:Grik1 UTSW 16 87936026 missense probably damaging 1.00
R6141:Grik1 UTSW 16 87896872 missense probably benign 0.00
R6188:Grik1 UTSW 16 88056071 missense probably benign 0.06
R6335:Grik1 UTSW 16 87947906 missense probably damaging 1.00
R6610:Grik1 UTSW 16 88034312 missense probably damaging 1.00
R6737:Grik1 UTSW 16 88051391 missense probably damaging 1.00
R7275:Grik1 UTSW 16 87912820 missense probably benign 0.06
R7876:Grik1 UTSW 16 87923233 missense
R7959:Grik1 UTSW 16 87923233 missense
R8021:Grik1 UTSW 16 87914222 missense
R8027:Grik1 UTSW 16 87936005 missense
R8096:Grik1 UTSW 16 88006467 missense
R8266:Grik1 UTSW 16 87947979 missense probably benign
RF016:Grik1 UTSW 16 88034186 missense
RF022:Grik1 UTSW 16 87896337 missense
X0018:Grik1 UTSW 16 87946596 missense probably damaging 1.00
Z1177:Grik1 UTSW 16 87946684 missense
Predicted Primers PCR Primer
(F):5'- ATGAGCCAGGATGCTGGATG -3'
(R):5'- ACTTTCAACTCAGTGATCCAAGG -3'

Sequencing Primer
(F):5'- GGAAGTGCCAAGAAAGTCACTTTTTC -3'
(R):5'- TGATCCAAGGCAACAATGGTTC -3'
Posted On2016-02-04