Incidental Mutation 'R4804:Cd226'
ID370589
Institutional Source Beutler Lab
Gene Symbol Cd226
Ensembl Gene ENSMUSG00000034028
Gene NameCD226 antigen
SynonymsTLiSA1, DNAM-1, Pta1, DNAM1
MMRRC Submission 041998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4804 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location89197431-89270201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89207168 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 63 (V63A)
Ref Sequence ENSEMBL: ENSMUSP00000043551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037142] [ENSMUST00000097496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037142
AA Change: V63A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028
AA Change: V63A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097496
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and increased incidence of tumor formation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A T 19: 5,503,000 M251K possibly damaging Het
4930527J03Rik T C 1: 178,276,109 noncoding transcript Het
Akap2 T C 4: 57,854,688 S67P probably benign Het
Ap4e1 T C 2: 127,043,758 probably null Het
Apbb1ip T C 2: 22,823,598 probably null Het
Apol11b T A 15: 77,635,266 I205F probably damaging Het
Arl6ip1 A T 7: 118,129,552 probably null Het
Barx2 A G 9: 31,846,812 S277P unknown Het
BC035947 T G 1: 78,497,876 D673A probably damaging Het
Cacna2d1 A T 5: 16,359,208 I930F probably damaging Het
Cdk8 A G 5: 146,296,399 K236E probably damaging Het
Cds1 T C 5: 101,821,523 L449P probably damaging Het
Celsr1 T C 15: 85,937,953 D1721G possibly damaging Het
Chtf18 T C 17: 25,719,257 D934G probably benign Het
Clk4 T A 11: 51,281,323 L271Q probably damaging Het
Cnnm1 C A 19: 43,491,575 T853N probably benign Het
Col26a1 A G 5: 136,836,725 V103A probably damaging Het
D5Ertd579e C T 5: 36,629,652 probably null Het
Ddx39 A G 8: 83,721,095 K190E probably damaging Het
Dgkg G A 16: 22,575,193 probably benign Het
Dnajc14 A T 10: 128,814,057 H477L probably benign Het
Dytn A G 1: 63,643,366 V374A probably benign Het
Gfra2 T C 14: 70,925,921 Y215H possibly damaging Het
Grik1 A G 16: 87,957,569 I376T probably damaging Het
Gzmm A T 10: 79,695,056 T231S probably benign Het
Hecw1 A G 13: 14,305,985 S499P probably benign Het
Hhla1 T C 15: 65,923,099 I511V probably benign Het
Ifnlr1 A G 4: 135,705,336 D361G possibly damaging Het
Ikzf3 A G 11: 98,490,574 V60A probably benign Het
Ipo4 G C 14: 55,630,856 R495G possibly damaging Het
Kat2b-ps A T 5: 93,392,533 noncoding transcript Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mblac2 T A 13: 81,750,309 L268* probably null Het
Mipep C T 14: 60,802,952 T307I probably damaging Het
Ms4a14 A G 19: 11,304,040 S385P possibly damaging Het
Myh2 T A 11: 67,186,502 I821N possibly damaging Het
Myo5c A T 9: 75,245,024 I65F probably damaging Het
Neurog1 A G 13: 56,251,766 L56P probably benign Het
Nrsn1 C A 13: 25,253,597 C116F probably benign Het
Nynrin T C 14: 55,864,869 V665A probably benign Het
Olfr1369-ps1 T A 13: 21,116,005 Y104* probably null Het
Olfr1490 A G 19: 13,654,518 M30V probably benign Het
Olfr988 T C 2: 85,353,081 I282V probably benign Het
Pcdhac1 C T 18: 37,091,178 S348L possibly damaging Het
Pcnx4 T C 12: 72,574,202 I932T probably benign Het
Pfkl G A 10: 77,991,394 T486I probably benign Het
Pi4ka A T 16: 17,308,161 M1115K possibly damaging Het
Rilpl1 A G 5: 124,493,765 W173R probably damaging Het
Rnf111 A T 9: 70,430,957 C900S possibly damaging Het
Ryr2 A G 13: 11,717,097 V2319A probably damaging Het
Scnn1g AATCCTGCAGGTGA AA 7: 121,763,080 probably null Het
Slc25a13 A T 6: 6,109,213 L383H probably damaging Het
Slco2a1 C T 9: 103,073,184 P325L probably damaging Het
Stoml2 T C 4: 43,029,882 N162S probably benign Het
Syne1 G T 10: 5,349,310 Q982K possibly damaging Het
Tbc1d31 C T 15: 57,951,106 Q568* probably null Het
Tbc1d9 G A 8: 83,255,925 probably null Het
Tbx3 A G 5: 119,680,512 D384G possibly damaging Het
Tecta T C 9: 42,398,237 I14V probably benign Het
Tgm1 A T 14: 55,705,619 V588E probably benign Het
Tpk1 A C 6: 43,593,078 probably benign Het
Tspear A T 10: 77,776,957 probably null Het
Ubxn10 G T 4: 138,721,204 Q54K possibly damaging Het
Ubxn4 C T 1: 128,266,404 R312* probably null Het
Vmn1r230 A T 17: 20,847,083 K178M probably damaging Het
Zfp143 G A 7: 110,088,769 V445I probably damaging Het
Zfp688 C A 7: 127,421,885 W40C probably damaging Het
Other mutations in Cd226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Cd226 APN 18 89269063 missense probably damaging 1.00
IGL02292:Cd226 APN 18 89207092 missense possibly damaging 0.55
IGL02298:Cd226 APN 18 89207051 missense probably damaging 1.00
IGL02408:Cd226 APN 18 89207327 missense probably benign
R0179:Cd226 UTSW 18 89207139 missense probably benign 0.00
R0558:Cd226 UTSW 18 89207214 missense probably benign 0.30
R0602:Cd226 UTSW 18 89269011 missense probably benign 0.00
R0744:Cd226 UTSW 18 89207020 intron probably benign
R0833:Cd226 UTSW 18 89207020 intron probably benign
R1125:Cd226 UTSW 18 89267922 missense probably benign
R1352:Cd226 UTSW 18 89247174 missense probably damaging 1.00
R1355:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1370:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1998:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R2004:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2006:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2045:Cd226 UTSW 18 89207362 missense probably benign 0.10
R2354:Cd226 UTSW 18 89246983 critical splice acceptor site probably null
R2518:Cd226 UTSW 18 89207327 missense probably benign
R4603:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R5964:Cd226 UTSW 18 89207183 missense probably benign 0.02
R5999:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R7205:Cd226 UTSW 18 89247198 missense probably damaging 1.00
R7456:Cd226 UTSW 18 89206623 missense probably damaging 0.96
R7509:Cd226 UTSW 18 89247071 missense probably benign 0.10
R7714:Cd226 UTSW 18 89247309 missense probably damaging 1.00
X0024:Cd226 UTSW 18 89263285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTTCGTCATCATTGGATC -3'
(R):5'- TGGGAGACACTTGCACTCAG -3'

Sequencing Primer
(F):5'- GGCTTCGTCATCATTGGATCTAATC -3'
(R):5'- GAGACACTTGCACTCAGAAATG -3'
Posted On2016-02-04