Incidental Mutation 'R0421:Knop1'
List |< first << previous [record 32 of 70] next >> last >|
ID37059
Institutional Source Beutler Lab
Gene Symbol Knop1
Ensembl Gene ENSMUSG00000030980
Gene Namelysine rich nucleolar protein 1
SynonymsTsg118, 2310008H09Rik
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0421 (G1)
Quality Score90
Status Validated
Chromosome7
Chromosomal Location118842222-118856254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118855629 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 50 (E50K)
Ref Sequence ENSEMBL: ENSMUSP00000068142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063607] [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000106549] [ENSMUST00000106550] [ENSMUST00000116280] [ENSMUST00000126792] [ENSMUST00000152136] [ENSMUST00000152309] [ENSMUST00000208658]
Predicted Effect silent
Transcript: ENSMUST00000033277
SMART Domains Protein: ENSMUSP00000033277
Gene: ENSMUSG00000030980

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 435 509 1.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063607
AA Change: E50K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068142
Gene: ENSMUSG00000030980
AA Change: E50K

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 239 251 6.9e-7 PROSPERO
internal_repeat_1 255 267 6.9e-7 PROSPERO
Pfam:SMAP 273 347 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098087
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106547
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106549
SMART Domains Protein: ENSMUSP00000102159
Gene: ENSMUSG00000030980

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
internal_repeat_1 187 199 1.42e-6 PROSPERO
internal_repeat_1 203 215 1.42e-6 PROSPERO
Pfam:SMAP 221 295 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106550
AA Change: E50K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102160
Gene: ENSMUSG00000030980
AA Change: E50K

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 250 324 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116280
AA Change: E50K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111984
Gene: ENSMUSG00000030980
AA Change: E50K

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
internal_repeat_1 401 413 1.29e-7 PROSPERO
internal_repeat_1 417 429 1.29e-7 PROSPERO
Pfam:SMAP 436 509 7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126792
AA Change: E50K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114727
Gene: ENSMUSG00000030980
AA Change: E50K

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
internal_repeat_1 216 228 4.11e-7 PROSPERO
internal_repeat_1 232 244 4.11e-7 PROSPERO
Pfam:SMAP 251 324 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Predicted Effect probably benign
Transcript: ENSMUST00000152309
SMART Domains Protein: ENSMUSP00000117151
Gene: ENSMUSG00000030980

DomainStartEndE-ValueType
low complexity region 71 83 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153518
Predicted Effect probably benign
Transcript: ENSMUST00000208658
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar protein that interacts with zinc finger 106 protein. The encoded protein has several of the same characteristics as nucleostemin and may be involved in testis development. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Knop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Knop1 APN 7 118852644 missense probably benign 0.09
IGL00840:Knop1 APN 7 118852798 missense probably damaging 0.96
IGL01484:Knop1 APN 7 118852809 missense probably damaging 0.99
IGL01608:Knop1 APN 7 118845796 missense probably benign 0.30
IGL03094:Knop1 APN 7 118853151 missense possibly damaging 0.92
R0147:Knop1 UTSW 7 118845838 missense probably benign 0.35
R0403:Knop1 UTSW 7 118853053 missense probably damaging 0.99
R1483:Knop1 UTSW 7 118853050 missense probably damaging 0.96
R1513:Knop1 UTSW 7 118852449 unclassified probably benign
R1541:Knop1 UTSW 7 118855786 unclassified probably benign
R2366:Knop1 UTSW 7 118852528 missense possibly damaging 0.60
R2372:Knop1 UTSW 7 118853217 missense probably damaging 1.00
R2872:Knop1 UTSW 7 118855963 critical splice donor site probably null
R3001:Knop1 UTSW 7 118852449 unclassified probably benign
R3002:Knop1 UTSW 7 118852449 unclassified probably benign
R4723:Knop1 UTSW 7 118855864 unclassified probably benign
R4916:Knop1 UTSW 7 118846076 missense probably damaging 1.00
R5286:Knop1 UTSW 7 118855770 missense probably damaging 0.99
R5326:Knop1 UTSW 7 118853272 missense possibly damaging 0.91
R5733:Knop1 UTSW 7 118846082 missense probably damaging 0.96
R5950:Knop1 UTSW 7 118853334 missense probably damaging 1.00
R6741:Knop1 UTSW 7 118845838 missense possibly damaging 0.79
R7654:Knop1 UTSW 7 118845809 missense unknown
R7850:Knop1 UTSW 7 118850637 missense unknown
R7933:Knop1 UTSW 7 118850637 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTATGCCCAGTGTGAAGGCACTC -3'
(R):5'- TGGACGCGGTTTCTACAGCAAC -3'

Sequencing Primer
(F):5'- CTCGGAGACTGTAACTCACTAGG -3'
(R):5'- GGTTTCTACAGCAACCCAGG -3'
Posted On2013-05-09