Incidental Mutation 'R4805:Steap3'
ID370596
Institutional Source Beutler Lab
Gene Symbol Steap3
Ensembl Gene ENSMUSG00000026389
Gene NameSTEAP family member 3
SynonymspHyde, 1010001D01Rik
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4805 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location120190757-120272705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120243886 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 163 (H163L)
Ref Sequence ENSEMBL: ENSMUSP00000108262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112639] [ENSMUST00000112640] [ENSMUST00000112641] [ENSMUST00000112643] [ENSMUST00000140490]
Predicted Effect probably benign
Transcript: ENSMUST00000112639
AA Change: H125L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108258
Gene: ENSMUSG00000026389
AA Change: H125L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112640
AA Change: H125L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108259
Gene: ENSMUSG00000026389
AA Change: H125L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112641
AA Change: H125L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108260
Gene: ENSMUSG00000026389
AA Change: H125L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112643
AA Change: H163L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108262
Gene: ENSMUSG00000026389
AA Change: H163L

DomainStartEndE-ValueType
Pfam:F420_oxidored 68 155 7.3e-19 PFAM
Pfam:Ferric_reduct 297 445 7.9e-15 PFAM
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140490
AA Change: H125L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121046
Gene: ENSMUSG00000026389
AA Change: H125L

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 1.6e-18 PFAM
Pfam:Ferric_reduct 259 406 3.6e-20 PFAM
Meta Mutation Damage Score 0.1890 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous inactivation of this gene results in microcytic anemia, increased erythrocyte cell number, abnormal reticulocyte morphology, anisopoikilocytosis, decreased mean corpuscular hemoglobin, decreased mean corpuscular volume, and thrombocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Steap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Steap3 APN 1 120241574 missense probably benign 0.02
IGL02307:Steap3 APN 1 120241660 nonsense probably null
IGL02413:Steap3 APN 1 120241772 missense probably damaging 0.99
IGL03237:Steap3 APN 1 120243790 missense probably damaging 1.00
R0076:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R0157:Steap3 UTSW 1 120227649 makesense probably null
R0468:Steap3 UTSW 1 120234300 missense probably damaging 1.00
R0507:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R0727:Steap3 UTSW 1 120227817 missense possibly damaging 0.91
R0742:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R1439:Steap3 UTSW 1 120227820 missense probably damaging 1.00
R1728:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1728:Steap3 UTSW 1 120234378 missense probably benign
R1729:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1729:Steap3 UTSW 1 120234378 missense probably benign
R1730:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1730:Steap3 UTSW 1 120234378 missense probably benign
R1739:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1739:Steap3 UTSW 1 120234378 missense probably benign
R1762:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1762:Steap3 UTSW 1 120234378 missense probably benign
R1783:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1783:Steap3 UTSW 1 120234378 missense probably benign
R1785:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1785:Steap3 UTSW 1 120234378 missense probably benign
R1902:Steap3 UTSW 1 120241734 missense probably benign
R3827:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R4574:Steap3 UTSW 1 120241456 missense probably benign 0.00
R5176:Steap3 UTSW 1 120243767 critical splice donor site probably null
R5285:Steap3 UTSW 1 120241880 missense probably damaging 0.98
R5481:Steap3 UTSW 1 120241724 missense probably benign
R5906:Steap3 UTSW 1 120244001 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6922:Steap3 UTSW 1 120243894 missense probably damaging 1.00
R7258:Steap3 UTSW 1 120243986 missense possibly damaging 0.73
R7278:Steap3 UTSW 1 120234357 missense probably damaging 0.97
R7315:Steap3 UTSW 1 120227912 missense probably benign 0.01
R7439:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7440:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7441:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7444:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7452:Steap3 UTSW 1 120227855 missense possibly damaging 0.47
Z1176:Steap3 UTSW 1 120241623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCTGCTGTGTAAGATGAG -3'
(R):5'- TGGACAGTGATGGCAGTCTG -3'

Sequencing Primer
(F):5'- ATGAGATTTTTATAGTGGCATGCAG -3'
(R):5'- AAAGTGGGCATCCTGGGC -3'
Posted On2016-02-04