Incidental Mutation 'R0421:Eif3c'
Institutional Source Beutler Lab
Gene Symbol Eif3c
Ensembl Gene ENSMUSG00000030738
Gene Nameeukaryotic translation initiation factor 3, subunit C
SynonymsNIPIL(A3), 3230401O13Rik, 110kDa, Xs, Eif3s8, Xsl
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosomal Location126546455-126566411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126563712 bp
Amino Acid Change Asparagine to Serine at position 133 (N133S)
Ref Sequence ENSEMBL: ENSMUSP00000032992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032992] [ENSMUST00000180459] [ENSMUST00000205949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032992
AA Change: N133S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032992
Gene: ENSMUSG00000030738
AA Change: N133S

low complexity region 8 22 N/A INTRINSIC
Pfam:eIF-3c_N 29 703 9.6e-267 PFAM
PINT 776 864 9.7e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122504
Predicted Effect unknown
Transcript: ENSMUST00000180459
AA Change: N133S
SMART Domains Protein: ENSMUSP00000138023
Gene: ENSMUSG00000030738
AA Change: N133S

low complexity region 6 17 N/A INTRINSIC
low complexity region 113 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205949
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mutations in this gene result in a range of abnormal limb development, including polydactyly, and white coat spotting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Ccr9 A T 9: 123,779,606 M118L probably benign Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Other mutations in Eif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Eif3c APN 7 126559008 missense probably benign
IGL01380:Eif3c APN 7 126564413 intron probably benign
IGL01434:Eif3c APN 7 126556410 missense probably damaging 0.99
IGL01534:Eif3c APN 7 126557695 missense probably benign 0.07
IGL02493:Eif3c APN 7 126558901 missense probably damaging 0.98
IGL02544:Eif3c APN 7 126547612 nonsense probably null
IGL02821:Eif3c APN 7 126558659 missense probably benign
IGL02963:Eif3c APN 7 126556820 missense probably benign 0.00
R0194:Eif3c UTSW 7 126558623 unclassified probably benign
R1486:Eif3c UTSW 7 126564721 missense probably damaging 1.00
R2378:Eif3c UTSW 7 126552325 missense probably damaging 0.99
R4135:Eif3c UTSW 7 126566299 unclassified probably benign
R4223:Eif3c UTSW 7 126566299 unclassified probably benign
R4225:Eif3c UTSW 7 126566299 unclassified probably benign
R4898:Eif3c UTSW 7 126557454 missense probably benign 0.03
R5144:Eif3c UTSW 7 126563066 missense probably benign
R5246:Eif3c UTSW 7 126557238 missense possibly damaging 0.66
R5845:Eif3c UTSW 7 126564755 missense probably damaging 0.99
R6495:Eif3c UTSW 7 126547500 missense probably damaging 1.00
R6884:Eif3c UTSW 7 126556879 missense probably benign 0.01
R7236:Eif3c UTSW 7 126552323 missense possibly damaging 0.63
R7691:Eif3c UTSW 7 126551990 missense possibly damaging 0.95
R7744:Eif3c UTSW 7 126558894 missense probably damaging 1.00
X0065:Eif3c UTSW 7 126552085 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcagcacatatactaaaattggaac -3'
Posted On2013-05-09