Incidental Mutation 'R4805:Rad21l'
ID370605
Institutional Source Beutler Lab
Gene Symbol Rad21l
Ensembl Gene ENSMUSG00000074704
Gene NameRAD21-like (S. pombe)
SynonymsGm14160
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4805 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location151645404-151668533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 151668007 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 58 (H58P)
Ref Sequence ENSEMBL: ENSMUSP00000136918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096439] [ENSMUST00000180195]
Predicted Effect probably damaging
Transcript: ENSMUST00000096439
AA Change: H58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094174
Gene: ENSMUSG00000074704
AA Change: H58P

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 111 3.9e-43 PFAM
low complexity region 198 213 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Pfam:Rad21_Rec8 493 546 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180195
AA Change: H58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136918
Gene: ENSMUSG00000074704
AA Change: H58P

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 106 5.7e-40 PFAM
low complexity region 198 213 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
Pfam:Rad21_Rec8 496 549 1.3e-19 PFAM
Meta Mutation Damage Score 0.7524 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and reduced female fertility associated with abnormal meiosis and synaptonemal complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Rad21l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Rad21l APN 2 151653516 missense probably benign 0.04
IGL00815:Rad21l APN 2 151667989 missense probably damaging 1.00
IGL00847:Rad21l APN 2 151660715 missense probably benign 0.00
IGL01545:Rad21l APN 2 151655164 missense probably benign 0.00
IGL02983:Rad21l APN 2 151655120 missense probably damaging 1.00
IGL03001:Rad21l APN 2 151668469 missense probably damaging 1.00
3-1:Rad21l UTSW 2 151654647 missense possibly damaging 0.52
R0219:Rad21l UTSW 2 151654588 splice site probably benign
R0382:Rad21l UTSW 2 151645443 missense probably damaging 1.00
R0413:Rad21l UTSW 2 151651931 missense probably benign
R0511:Rad21l UTSW 2 151649069 splice site probably benign
R1555:Rad21l UTSW 2 151658428 missense probably benign 0.03
R1606:Rad21l UTSW 2 151654686 missense probably damaging 1.00
R1696:Rad21l UTSW 2 151668527 missense probably damaging 1.00
R1951:Rad21l UTSW 2 151655259 missense probably benign 0.04
R1999:Rad21l UTSW 2 151654701 critical splice acceptor site probably null
R2060:Rad21l UTSW 2 151645429 missense probably benign 0.21
R2068:Rad21l UTSW 2 151668007 missense probably damaging 1.00
R3037:Rad21l UTSW 2 151660780 missense probably damaging 1.00
R5185:Rad21l UTSW 2 151657462 missense probably benign 0.01
R5388:Rad21l UTSW 2 151653483 missense probably benign
R5504:Rad21l UTSW 2 151668437 missense probably damaging 1.00
R5530:Rad21l UTSW 2 151657510 missense probably benign 0.00
R6113:Rad21l UTSW 2 151657478 missense probably damaging 0.98
R6233:Rad21l UTSW 2 151653542 missense probably benign
R7096:Rad21l UTSW 2 151667920 missense probably benign 0.31
R7337:Rad21l UTSW 2 151658445 missense probably damaging 1.00
R7822:Rad21l UTSW 2 151655125 missense probably benign
Z1088:Rad21l UTSW 2 151668019 missense probably damaging 1.00
Z1176:Rad21l UTSW 2 151655232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACCTGAAATTACAGTATGCTCAC -3'
(R):5'- TCTGTACAAAGGCACTCCAATATAG -3'

Sequencing Primer
(F):5'- GTATGCTCACAACTAAAATAAACCAC -3'
(R):5'- AAGCTTTTATGGTTTTGCTGAATACG -3'
Posted On2016-02-04