Incidental Mutation 'R4805:Gstm2'
ID370613
Institutional Source Beutler Lab
Gene Symbol Gstm2
Ensembl Gene ENSMUSG00000040562
Gene Nameglutathione S-transferase, mu 2
SynonymsGstb2, Gstb-2
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4805 (G1)
Quality Score212
Status Validated
Chromosome3
Chromosomal Location107981702-107986453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107985095 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 105 (M105K)
Ref Sequence ENSEMBL: ENSMUSP00000012348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012348] [ENSMUST00000066530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012348
AA Change: M105K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562
AA Change: M105K

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066530
AA Change: M71K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066675
Gene: ENSMUSG00000040562
AA Change: M71K

DomainStartEndE-ValueType
Pfam:GST_N 1 48 6.8e-12 PFAM
Pfam:GST_C 70 158 8.4e-20 PFAM
Pfam:GST_C_3 84 156 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150808
Meta Mutation Damage Score 0.4146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Gstm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Gstm2 APN 3 107985243 splice site probably null
IGL01821:Gstm2 APN 3 107985053 missense possibly damaging 0.51
IGL02662:Gstm2 APN 3 107985062 missense possibly damaging 0.94
IGL02667:Gstm2 APN 3 107986108 missense probably damaging 1.00
IGL03088:Gstm2 APN 3 107986046 missense probably benign 0.00
IGL03341:Gstm2 APN 3 107984205 missense possibly damaging 0.86
R0415:Gstm2 UTSW 3 107984006 missense probably benign 0.37
R1239:Gstm2 UTSW 3 107984028 missense possibly damaging 0.61
R2213:Gstm2 UTSW 3 107986093 missense probably damaging 1.00
R2437:Gstm2 UTSW 3 107984053 splice site probably benign
R3765:Gstm2 UTSW 3 107984030 missense probably damaging 1.00
R4402:Gstm2 UTSW 3 107986054 missense probably benign 0.02
R5791:Gstm2 UTSW 3 107984128 critical splice donor site probably null
R6918:Gstm2 UTSW 3 107985241 splice site probably null
R7669:Gstm2 UTSW 3 107985676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGTCACTGTCGAGAGTCTG -3'
(R):5'- TTGCCCGAAAGCACAACCTG -3'

Sequencing Primer
(F):5'- ACTGGACCTTAGGCCAATGACTG -3'
(R):5'- ACAACCTGTGTGAGTGGGGC -3'
Posted On2016-02-04