Incidental Mutation 'R4805:Ttc41'
ID 370630
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 041999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R4805 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86729798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 405 (M405I)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075632
AA Change: M405I

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: M405I

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: M405I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh11 T A 16: 14,234,465 Q379L possibly damaging Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGCACCACTACTTTGGGCC -3'
(R):5'- CCTAAGTAATGGGGTCTTCTCC -3'

Sequencing Primer
(F):5'- CCTGAATGTCTTGAGGAAGCC -3'
(R):5'- GTCTAGTACCAGGATGCA -3'
Posted On 2016-02-04