Incidental Mutation 'R4805:Myh11'
ID370649
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
MMRRC Submission 041999-MU
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4805 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14234465 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 379 (Q379L)
Ref Sequence ENSEMBL: ENSMUSP00000155052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably benign
Transcript: ENSMUST00000090287
AA Change: Q379L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: Q379L

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000230397
AA Change: Q379L

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000231567
AA Change: Q386L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.4187 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T A 15: 84,417,196 H82L probably damaging Het
4930407I10Rik T A 15: 82,066,427 Y1508* probably null Het
4931414P19Rik T C 14: 54,595,454 E88G probably benign Het
Acaa1b A G 9: 119,156,946 S17P probably benign Het
Arhgef7 G A 8: 11,831,552 E565K probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bpnt1 T A 1: 185,345,307 probably null Het
Ccnt1 C T 15: 98,544,308 V360I probably benign Het
Chd4 T C 6: 125,128,945 S1829P possibly damaging Het
Dennd1b A T 1: 139,053,384 N112I probably damaging Het
Fat2 A T 11: 55,283,979 D1969E probably benign Het
Flywch1 A C 17: 23,760,617 D394E probably benign Het
Gal3st4 T A 5: 138,265,471 probably null Het
Gm14403 T C 2: 177,508,699 L146P probably damaging Het
Gm5283 G T 3: 17,230,959 noncoding transcript Het
Gpr161 T A 1: 165,306,460 L97Q probably damaging Het
Gstm2 A T 3: 107,985,095 M105K possibly damaging Het
Hecw2 A G 1: 53,840,859 Y1264H probably damaging Het
Ifi206 T A 1: 173,481,386 Q348L possibly damaging Het
Ighv1-83 A T 12: 115,963,869 M87K possibly damaging Het
Ighv2-7 A T 12: 113,807,534 S44T probably damaging Het
Ipo7 T A 7: 110,051,484 N884K probably benign Het
Itga2b T C 11: 102,467,866 N75S probably benign Het
Krt20 A G 11: 99,428,985 V431A unknown Het
Krt24 A T 11: 99,283,626 I205N possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc31 A T 3: 30,691,297 L67* probably null Het
Lrrc37a A G 11: 103,504,309 F97L probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mgat4d T G 8: 83,358,158 probably null Het
Mrgprb3 C T 7: 48,643,306 V166I probably benign Het
Myh7 T C 14: 54,985,133 S782G probably benign Het
Nobox T C 6: 43,305,119 D340G probably damaging Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr1453 T A 19: 13,028,297 I11F probably benign Het
Olfr329-ps G A 11: 58,542,570 T315I probably benign Het
Pikfyve T A 1: 65,268,800 I1845N probably damaging Het
Pramef20 A G 4: 144,377,020 Y179H probably benign Het
Rad21l T G 2: 151,668,007 H58P probably damaging Het
Scnn1g T C 7: 121,746,602 L316S probably damaging Het
Serpina5 G A 12: 104,102,201 V174I probably damaging Het
Shank1 T C 7: 44,343,711 S788P unknown Het
Snap47 A G 11: 59,428,517 V265A possibly damaging Het
Steap3 T A 1: 120,243,886 H163L probably benign Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tet2 A G 3: 133,467,315 F1729L probably benign Het
Thsd7b T C 1: 130,188,539 V1343A probably benign Het
Thumpd2 G A 17: 81,026,701 T486I probably damaging Het
Ttc41 G T 10: 86,729,798 M405I possibly damaging Het
Ttn T C 2: 76,747,529 D24340G probably damaging Het
Vmn1r10 T G 6: 57,113,617 F65V possibly damaging Het
Vmn2r118 G T 17: 55,592,581 D774E probably damaging Het
Vmn2r13 C T 5: 109,156,465 C700Y probably damaging Het
Wsb1 A C 11: 79,240,391 M393R possibly damaging Het
Zmat3 A G 3: 32,343,355 Y214H probably benign Het
Zswim3 C T 2: 164,820,179 T193I possibly damaging Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
R7644:Myh11 UTSW 16 14221824 missense
R7838:Myh11 UTSW 16 14209617 missense
R7905:Myh11 UTSW 16 14207681 nonsense probably null
R7921:Myh11 UTSW 16 14209617 missense
R7988:Myh11 UTSW 16 14207681 nonsense probably null
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Z1176:Myh11 UTSW 16 14239396 missense probably null
Z1176:Myh11 UTSW 16 14277775 missense
Z1177:Myh11 UTSW 16 14209595 missense
Predicted Primers PCR Primer
(F):5'- GATGAGCAAGTAGATACCATGTATATG -3'
(R):5'- AACGAGCCACATGTTTATGACC -3'

Sequencing Primer
(F):5'- GGGTTGAATGATAAATGTGTAAAAGG -3'
(R):5'- GCAGAGATGACCTTGCACTTATG -3'
Posted On2016-02-04