Incidental Mutation 'R4806:Cd84'
ID370658
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene NameCD84 antigen
SynonymsCDw84, A130013D22Rik, SLAMF5
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171839697-171890718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171852121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000115674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000135386] [ENSMUST00000136479] [ENSMUST00000155802]
Predicted Effect probably benign
Transcript: ENSMUST00000042302
AA Change: Y122C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: Y122C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128189
Predicted Effect probably benign
Transcript: ENSMUST00000135386
AA Change: Y122C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115674
Gene: ENSMUSG00000038147
AA Change: Y122C

DomainStartEndE-ValueType
IG 26 126 3.16e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136479
AA Change: Y122C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: Y122C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155802
AA Change: Y122C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: Y122C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171852137 critical splice donor site probably null
IGL01371:Cd84 APN 1 171886370 missense probably benign 0.36
IGL03035:Cd84 APN 1 171852034 missense probably damaging 0.99
IGL03098:Cd84 APN 1 171872700 missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171872927 missense probably benign 0.00
R1244:Cd84 UTSW 1 171851830 missense probably damaging 0.99
R1438:Cd84 UTSW 1 171852118 missense probably damaging 1.00
R1459:Cd84 UTSW 1 171851943 missense probably benign 0.02
R1654:Cd84 UTSW 1 171884606 missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1659:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171884585 splice site probably null
R1990:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2098:Cd84 UTSW 1 171885581 missense probably benign 0.07
R4674:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4828:Cd84 UTSW 1 171872748 missense probably damaging 0.97
R4908:Cd84 UTSW 1 171872865 missense probably damaging 0.96
R5366:Cd84 UTSW 1 171873305 missense probably damaging 1.00
R5725:Cd84 UTSW 1 171873361 missense probably benign 0.00
R5883:Cd84 UTSW 1 171872838 missense possibly damaging 0.58
R6722:Cd84 UTSW 1 171872777 missense probably damaging 0.98
R6966:Cd84 UTSW 1 171886409 missense possibly damaging 0.93
R7513:Cd84 UTSW 1 171884618 missense probably benign 0.01
R7733:Cd84 UTSW 1 171840659 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAACATTGCCTGGACTTCTCAATC -3'
(R):5'- AAGTCTGTCAAGGCCAGAAG -3'

Sequencing Primer
(F):5'- CTGTTGCTTTTATAAAACCAGGAGTC -3'
(R):5'- TCTGTCAAGGCCAGAAGTAAAGTTAG -3'
Posted On2016-02-04