Incidental Mutation 'R4806:Kif3b'
ID370660
Institutional Source Beutler Lab
Gene Symbol Kif3b
Ensembl Gene ENSMUSG00000027475
Gene Namekinesin family member 3B
Synonyms
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153291413-153333390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153320368 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 500 (A500T)
Ref Sequence ENSEMBL: ENSMUSP00000028977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028977]
Predicted Effect probably damaging
Transcript: ENSMUST00000028977
AA Change: A500T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475
AA Change: A500T

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Meta Mutation Damage Score 0.4246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a heterodimer with kinesin family member 3A to aid in chromosome movement during mitosis and meiosis. The encoded protein is a plus end-directed microtubule motor and can interact with the SMC3 subunit of the cohesin complex. In addition, the encoded protein may be involved in the intracellular movement of membranous organelles. This protein and kinesin family member 3A form the kinesin II subfamily of the kinesin superfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygoous for a targeted null mutation are growth retarded and display neural tube defects, incomplete embryo turning, randomized left-right assymetry, pericardial edema, and die during the midgestational period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Kif3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kif3b APN 2 153317131 missense probably damaging 0.99
IGL00927:Kif3b APN 2 153316461 missense possibly damaging 0.89
IGL02121:Kif3b APN 2 153317274 missense probably damaging 0.99
IGL02302:Kif3b APN 2 153316948 missense probably damaging 1.00
IGL02306:Kif3b APN 2 153320652 missense probably damaging 1.00
IGL02348:Kif3b APN 2 153316893 missense probably damaging 0.98
IGL03111:Kif3b APN 2 153330068 missense probably benign 0.00
R1463:Kif3b UTSW 2 153330153 makesense probably null
R1474:Kif3b UTSW 2 153320315 missense probably damaging 1.00
R1485:Kif3b UTSW 2 153322931 splice site probably null
R1538:Kif3b UTSW 2 153317462 small deletion probably benign
R1834:Kif3b UTSW 2 153317485 missense probably benign 0.22
R2371:Kif3b UTSW 2 153322823 missense possibly damaging 0.66
R4051:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4208:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4504:Kif3b UTSW 2 153323644 critical splice donor site probably null
R4619:Kif3b UTSW 2 153316674 nonsense probably null
R4911:Kif3b UTSW 2 153317292 nonsense probably null
R7017:Kif3b UTSW 2 153329724 missense possibly damaging 0.87
X0026:Kif3b UTSW 2 153316321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAAGCCTGTTCTCTAGGTC -3'
(R):5'- TCTCGACGTTTCTGAGCAATAC -3'

Sequencing Primer
(F):5'- ATAAGCCTGTTCTCTAGGTCTTCCTG -3'
(R):5'- AGCTTGCCCTAGTGACCATG -3'
Posted On2016-02-04