Incidental Mutation 'R4806:Slco1a1'
ID370677
Institutional Source Beutler Lab
Gene Symbol Slco1a1
Ensembl Gene ENSMUSG00000041698
Gene Namesolute carrier organic anion transporter family, member 1a1
SynonymsOatp1, Slc21a1, Oatp1a1
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141907282-141946962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141909009 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 639 (L639F)
Ref Sequence ENSEMBL: ENSMUSP00000037022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042119] [ENSMUST00000168119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042119
AA Change: L639F

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037022
Gene: ENSMUSG00000041698
AA Change: L639F

DomainStartEndE-ValueType
Pfam:OATP 21 597 6e-168 PFAM
Pfam:MFS_1 22 410 4.7e-28 PFAM
Pfam:Kazal_2 445 486 1.2e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168119
SMART Domains Protein: ENSMUSP00000132386
Gene: ENSMUSG00000041698

DomainStartEndE-ValueType
Pfam:OATP 21 597 1.6e-168 PFAM
Pfam:MFS_1 22 410 1e-27 PFAM
Pfam:Kazal_2 445 486 4.6e-11 PFAM
Meta Mutation Damage Score 0.1953 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Slco1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slco1a1 APN 6 141909125 missense probably damaging 0.98
IGL00942:Slco1a1 APN 6 141946628 missense probably benign 0.00
IGL01301:Slco1a1 APN 6 141932530 splice site probably benign
IGL01306:Slco1a1 APN 6 141946587 nonsense probably null
IGL01774:Slco1a1 APN 6 141925613 nonsense probably null
IGL02097:Slco1a1 APN 6 141940039 missense possibly damaging 0.94
IGL02183:Slco1a1 APN 6 141921943 splice site probably benign
IGL02376:Slco1a1 APN 6 141924334 critical splice donor site probably null
IGL02550:Slco1a1 APN 6 141943465 missense probably benign 0.24
IGL02559:Slco1a1 APN 6 141921788 missense probably benign 0.01
IGL02825:Slco1a1 APN 6 141918617 missense probably damaging 1.00
IGL03352:Slco1a1 APN 6 141911885 missense probably benign 0.00
ANU23:Slco1a1 UTSW 6 141946587 nonsense probably null
R0041:Slco1a1 UTSW 6 141918459 splice site probably benign
R0153:Slco1a1 UTSW 6 141910701 splice site probably benign
R0610:Slco1a1 UTSW 6 141918461 critical splice donor site probably null
R0646:Slco1a1 UTSW 6 141925754 splice site probably benign
R0828:Slco1a1 UTSW 6 141921839 missense possibly damaging 0.89
R1674:Slco1a1 UTSW 6 141935935 missense probably damaging 0.99
R1848:Slco1a1 UTSW 6 141923111 missense probably benign 0.29
R3834:Slco1a1 UTSW 6 141943437 missense possibly damaging 0.94
R3953:Slco1a1 UTSW 6 141923107 missense probably damaging 1.00
R3974:Slco1a1 UTSW 6 141909093 missense probably benign 0.01
R4081:Slco1a1 UTSW 6 141935962 missense probably damaging 0.99
R4729:Slco1a1 UTSW 6 141908969 missense probably benign 0.00
R4752:Slco1a1 UTSW 6 141946614 missense possibly damaging 0.80
R4812:Slco1a1 UTSW 6 141918593 missense probably damaging 1.00
R4963:Slco1a1 UTSW 6 141923099 missense probably benign 0.26
R5641:Slco1a1 UTSW 6 141939969 missense probably damaging 1.00
R6044:Slco1a1 UTSW 6 141940017 missense probably benign 0.01
R6211:Slco1a1 UTSW 6 141909049 missense probably benign 0.20
R6225:Slco1a1 UTSW 6 141924489 missense possibly damaging 0.70
R6328:Slco1a1 UTSW 6 141932450 missense probably damaging 1.00
R6428:Slco1a1 UTSW 6 141925690 missense probably damaging 1.00
R6787:Slco1a1 UTSW 6 141936487 missense probably benign 0.00
R7182:Slco1a1 UTSW 6 141911839 missense probably damaging 1.00
R7305:Slco1a1 UTSW 6 141924497 missense probably damaging 1.00
R7328:Slco1a1 UTSW 6 141936408 missense possibly damaging 0.94
R7723:Slco1a1 UTSW 6 141909069 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTCCTTAAAGATGAGGATTCCTAC -3'
(R):5'- GTGTTAGAATGCCAGAGTACGG -3'

Sequencing Primer
(F):5'- CAGGCCAGTTGAAAACTCA -3'
(R):5'- ATCCTTATAGGCACTCCTGGAGATG -3'
Posted On2016-02-04