Incidental Mutation 'R4806:Ntn4'
ID370689
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Namenetrin 4
Synonymsbeta-netrin
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93640681-93747207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93644500 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 29 (R29C)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
Predicted Effect probably damaging
Transcript: ENSMUST00000020204
AA Change: R29C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R29C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147080
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Meta Mutation Damage Score 0.1655 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCATGGTCCCGTTTG -3'
(R):5'- CCTGAAGGATGAGTCTGCCATG -3'

Sequencing Primer
(F):5'- CATGGTCCCGTTTGCTAAATTC -3'
(R):5'- CCATGGCAGAGGGTGGGTG -3'
Posted On2016-02-04