Mutagenetix > Incidental Mutation

Incidental Mutation 'R4806:Ints2'

370690

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

042425-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4806 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86256209 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 37 (L37P)

Ref Sequence

ENSEMBL: ENSMUSP00000116633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: L37P

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: L37P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: L37P

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: L37P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130614

Predicted Effect

probably benign
Transcript: ENSMUST00000132024
AA Change: L37P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068
AA Change: L37P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	140	1e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

probably benign
Transcript: ENSMUST00000136469
AA Change: L37P

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068
AA Change: L37P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	98	6.5e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139285
AA Change: L37P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: L37P

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.6127

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	A	G	7: 27,565,645		probably null	Het
2410137M14Rik	T	A	17: 36,978,854	H28L	probably benign	Het
4930562C15Rik	T	C	16: 4,849,672	F309S	unknown	Het
Acd	A	G	8: 105,698,290	V406A	possibly damaging	Het
Acin1	A	T	14: 54,679,228		probably benign	Het
Agbl4	T	C	4: 110,955,637	V118A	probably damaging	Het
Arhgap5	A	G	12: 52,518,703	D819G	probably damaging	Het
BC049715	A	T	6: 136,839,929	I56F	possibly damaging	Het
C1rb	A	T	6: 124,574,949	Q270L	probably benign	Het
Cadps2	C	T	6: 23,688,860	R121Q	probably damaging	Het
Cd84	A	G	1: 171,852,121	Y122C	probably benign	Het
Cklf	C	A	8: 104,257,435	P77T	probably damaging	Het
Clrn2	T	C	5: 45,454,004	L65P	probably damaging	Het
Csde1	TCCTCGACCT	TCCT	3: 103,056,369		probably benign	Het
Csf2rb2	T	C	15: 78,285,290	D446G	probably benign	Het
Csmd3	T	C	15: 48,314,068	E358G	probably benign	Het
Dmkn	C	T	7: 30,771,242	T385I	possibly damaging	Het
Dnah10	A	G	5: 124,819,344	T3591A	probably damaging	Het
Dpp9	A	G	17: 56,190,030	L734P	probably damaging	Het
Edem2	A	G	2: 155,728,993	V39A	possibly damaging	Het
Glmp	A	C	3: 88,326,013		probably benign	Het
Gm20775	T	C	Y: 10,641,885		noncoding transcript	Het
Gpr179	T	G	11: 97,349,784	D271A	possibly damaging	Het
Gtf2ird1	A	G	5: 134,383,896	V587A	probably damaging	Het
Igfn1	T	A	1: 135,967,357	T1824S	probably benign	Het
Ighmbp2	A	T	19: 3,261,589	I942N	probably damaging	Het
Irgq	T	A	7: 24,534,045	L437Q	probably damaging	Het
Kcnq4	A	T	4: 120,713,094	W351R	probably damaging	Het
Kif3b	G	A	2: 153,320,368	A500T	probably damaging	Het
Lpp	A	G	16: 24,661,680	D66G	probably damaging	Het
Mapkap1	G	A	2: 34,597,422		probably null	Het
Mc4r	T	A	18: 66,859,488	I185F	probably damaging	Het
Mdga1	T	C	17: 29,842,154	D621G	probably benign	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Myh11	A	T	16: 14,201,083		probably null	Het
Naip1	G	A	13: 100,425,621	A1012V	probably benign	Het
Ntn4	C	T	10: 93,644,500	R29C	probably damaging	Het
Plb1	G	A	5: 32,289,852	G321D	probably damaging	Het
Plxnd1	A	G	6: 115,960,855	V1510A	probably damaging	Het
Polr1e	T	A	4: 45,024,482	M131K	probably benign	Het
Prdm10	T	A	9: 31,329,941	*342R	probably null	Het
Prex2	T	C	1: 11,068,020	F108L	probably damaging	Het
Psmg2	T	A	18: 67,648,922	I186N	probably benign	Het
Ros1	T	A	10: 52,096,175	E1614D	probably damaging	Het
Sin3a	G	A	9: 57,086,742	V44M	probably damaging	Het
Slco1a1	G	A	6: 141,909,009	L639F	possibly damaging	Het
Smr2	T	G	5: 88,098,430	L101*	probably null	Het
Spata31d1b	C	T	13: 59,715,721	P228S	probably benign	Het
Stat5b	G	T	11: 100,790,797	H544N	probably benign	Het
Syk	A	T	13: 52,632,927	Y319F	probably benign	Het
Tln2	G	T	9: 67,331,733	T1087K	probably benign	Het
Tsc22d1	A	G	14: 76,416,988		probably null	Het
Vmn2r52	T	A	7: 10,159,242	T657S	probably damaging	Het
Vmn2r63	A	T	7: 42,926,890	S500T	probably benign	Het
Vps45	A	C	3: 96,046,413	V209G	probably benign	Het
Xrcc1	C	A	7: 24,570,480	A442E	probably benign	Het
Ythdc1	T	A	5: 86,822,845	V430E	probably damaging	Het
Zfp341	G	A	2: 154,645,866		probably benign	Het
Zfp422	A	T	6: 116,626,662	N125K	probably damaging	Het
Zfp53	T	A	17: 21,505,001	D58E	possibly damaging	Het
Zfp707	C	T	15: 75,973,151	Q66*	probably null	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTGGCATCTTGTTCTAGAGC -3'
(R):5'- GCCAATGCAAGGACCTACTAAG -3'

Sequencing Primer
(F):5'- GTTCTAGAGCGTGGAAGTCC -3'
(R):5'- AAGGTTGTCATATATGTGGGAAGTAG -3'

Posted On

2016-02-04