Incidental Mutation 'R4806:Csf2rb2'
ID370703
Institutional Source Beutler Lab
Gene Symbol Csf2rb2
Ensembl Gene ENSMUSG00000071714
Gene Namecolony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
SynonymsBil3, AIC2A, Il3r, Il3rb2, BetaIl3
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78282507-78305721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78285290 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 446 (D446G)
Ref Sequence ENSEMBL: ENSMUSP00000155013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096356] [ENSMUST00000230115]
Predicted Effect probably benign
Transcript: ENSMUST00000096356
AA Change: D555G

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094083
Gene: ENSMUSG00000071714
AA Change: D555G

DomainStartEndE-ValueType
SCOP:d1gh7a1 29 131 1e-57 SMART
FN3 137 225 3.73e-1 SMART
Pfam:IL6Ra-bind 248 342 6.3e-11 PFAM
FN3 343 425 2.83e0 SMART
transmembrane domain 445 467 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183491
Predicted Effect probably benign
Transcript: ENSMUST00000230115
AA Change: D446G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000230753
Meta Mutation Damage Score 0.2104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ighmbp2 A T 19: 3,261,589 I942N probably damaging Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Csf2rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Csf2rb2 APN 15 78284847 missense possibly damaging 0.78
IGL00765:Csf2rb2 APN 15 78292716 missense probably benign 0.17
IGL01383:Csf2rb2 APN 15 78297043 missense possibly damaging 0.90
IGL01975:Csf2rb2 APN 15 78288886 missense probably benign 0.01
IGL02330:Csf2rb2 APN 15 78285128 missense possibly damaging 0.85
IGL02365:Csf2rb2 APN 15 78287060 missense possibly damaging 0.92
IGL02756:Csf2rb2 APN 15 78284849 missense possibly damaging 0.95
R0269:Csf2rb2 UTSW 15 78288865 missense probably benign 0.09
R0462:Csf2rb2 UTSW 15 78285173 missense probably damaging 1.00
R0540:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0607:Csf2rb2 UTSW 15 78287908 missense probably benign 0.00
R0636:Csf2rb2 UTSW 15 78291960 nonsense probably null
R0782:Csf2rb2 UTSW 15 78286751 missense probably damaging 0.98
R1387:Csf2rb2 UTSW 15 78298214 missense probably damaging 0.99
R1799:Csf2rb2 UTSW 15 78297068 missense probably damaging 1.00
R1881:Csf2rb2 UTSW 15 78292535 intron probably null
R2079:Csf2rb2 UTSW 15 78288007 missense probably benign 0.13
R2108:Csf2rb2 UTSW 15 78292544 missense probably damaging 0.99
R2359:Csf2rb2 UTSW 15 78292776 missense probably benign 0.39
R4614:Csf2rb2 UTSW 15 78291702 missense probably damaging 1.00
R4900:Csf2rb2 UTSW 15 78285974 splice site probably null
R5206:Csf2rb2 UTSW 15 78292752 missense probably benign
R5270:Csf2rb2 UTSW 15 78291982 splice site probably null
R5427:Csf2rb2 UTSW 15 78288911 missense probably damaging 1.00
R6633:Csf2rb2 UTSW 15 78288952 missense probably benign 0.00
R7067:Csf2rb2 UTSW 15 78292494 missense probably damaging 1.00
R7102:Csf2rb2 UTSW 15 78297072 missense probably damaging 1.00
R7117:Csf2rb2 UTSW 15 78285185 missense probably damaging 1.00
R7423:Csf2rb2 UTSW 15 78292560 missense possibly damaging 0.65
R7453:Csf2rb2 UTSW 15 78285291 missense probably benign 0.14
R7705:Csf2rb2 UTSW 15 78284574 missense probably benign 0.02
R7788:Csf2rb2 UTSW 15 78292841 missense probably benign 0.12
R7849:Csf2rb2 UTSW 15 78284421 missense probably benign 0.09
R7851:Csf2rb2 UTSW 15 78288937 missense probably benign 0.10
R8057:Csf2rb2 UTSW 15 78285006 missense probably damaging 0.99
RF007:Csf2rb2 UTSW 15 78291926 missense probably benign 0.21
RF009:Csf2rb2 UTSW 15 78291927 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACATGTACTCCAAGGAGCCTG -3'
(R):5'- AGGCTTTCTGTAGAGCTCACC -3'

Sequencing Primer
(F):5'- AGTGCTGGCTTCAGGCTC -3'
(R):5'- ACCTGCTCTGGCTATACACTAAG -3'
Posted On2016-02-04