Incidental Mutation 'R4806:Ighmbp2'
ID370713
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
MMRRC Submission 042425-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4806 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3261589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 942 (I942N)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: I942N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: I942N

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000119292
AA Change: D885E
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: D885E

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143079
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Meta Mutation Damage Score 0.3812 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,645 probably null Het
2410137M14Rik T A 17: 36,978,854 H28L probably benign Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Acd A G 8: 105,698,290 V406A possibly damaging Het
Acin1 A T 14: 54,679,228 probably benign Het
Agbl4 T C 4: 110,955,637 V118A probably damaging Het
Arhgap5 A G 12: 52,518,703 D819G probably damaging Het
BC049715 A T 6: 136,839,929 I56F possibly damaging Het
C1rb A T 6: 124,574,949 Q270L probably benign Het
Cadps2 C T 6: 23,688,860 R121Q probably damaging Het
Cd84 A G 1: 171,852,121 Y122C probably benign Het
Cklf C A 8: 104,257,435 P77T probably damaging Het
Clrn2 T C 5: 45,454,004 L65P probably damaging Het
Csde1 TCCTCGACCT TCCT 3: 103,056,369 probably benign Het
Csf2rb2 T C 15: 78,285,290 D446G probably benign Het
Csmd3 T C 15: 48,314,068 E358G probably benign Het
Dmkn C T 7: 30,771,242 T385I possibly damaging Het
Dnah10 A G 5: 124,819,344 T3591A probably damaging Het
Dpp9 A G 17: 56,190,030 L734P probably damaging Het
Edem2 A G 2: 155,728,993 V39A possibly damaging Het
Glmp A C 3: 88,326,013 probably benign Het
Gm20775 T C Y: 10,641,885 noncoding transcript Het
Gpr179 T G 11: 97,349,784 D271A possibly damaging Het
Gtf2ird1 A G 5: 134,383,896 V587A probably damaging Het
Igfn1 T A 1: 135,967,357 T1824S probably benign Het
Ints2 A G 11: 86,256,209 L37P probably benign Het
Irgq T A 7: 24,534,045 L437Q probably damaging Het
Kcnq4 A T 4: 120,713,094 W351R probably damaging Het
Kif3b G A 2: 153,320,368 A500T probably damaging Het
Lpp A G 16: 24,661,680 D66G probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mc4r T A 18: 66,859,488 I185F probably damaging Het
Mdga1 T C 17: 29,842,154 D621G probably benign Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Myh11 A T 16: 14,201,083 probably null Het
Naip1 G A 13: 100,425,621 A1012V probably benign Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Plb1 G A 5: 32,289,852 G321D probably damaging Het
Plxnd1 A G 6: 115,960,855 V1510A probably damaging Het
Polr1e T A 4: 45,024,482 M131K probably benign Het
Prdm10 T A 9: 31,329,941 *342R probably null Het
Prex2 T C 1: 11,068,020 F108L probably damaging Het
Psmg2 T A 18: 67,648,922 I186N probably benign Het
Ros1 T A 10: 52,096,175 E1614D probably damaging Het
Sin3a G A 9: 57,086,742 V44M probably damaging Het
Slco1a1 G A 6: 141,909,009 L639F possibly damaging Het
Smr2 T G 5: 88,098,430 L101* probably null Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Stat5b G T 11: 100,790,797 H544N probably benign Het
Syk A T 13: 52,632,927 Y319F probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tsc22d1 A G 14: 76,416,988 probably null Het
Vmn2r52 T A 7: 10,159,242 T657S probably damaging Het
Vmn2r63 A T 7: 42,926,890 S500T probably benign Het
Vps45 A C 3: 96,046,413 V209G probably benign Het
Xrcc1 C A 7: 24,570,480 A442E probably benign Het
Ythdc1 T A 5: 86,822,845 V430E probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp422 A T 6: 116,626,662 N125K probably damaging Het
Zfp53 T A 17: 21,505,001 D58E possibly damaging Het
Zfp707 C T 15: 75,973,151 Q66* probably null Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R7960:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATGGCCAGTGTAGGACC -3'
(R):5'- AGCTGTGAAAGTTAGGCCTGG -3'

Sequencing Primer
(F):5'- GCCAGTGTAGGACCGTGTC -3'
(R):5'- TGTGAAAGTTAGGCCTGGGGAAG -3'
Posted On2016-02-04