Incidental Mutation 'R4807:Aspm'
ID370719
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 042426-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4807 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139477919 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1515 (F1515I)
Ref Sequence ENSEMBL: ENSMUSP00000059159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect probably damaging
Transcript: ENSMUST00000053364
AA Change: F1515I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: F1515I

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect probably benign
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.3277 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx24 A T 12: 103,419,461 F248L probably damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vmn1r213 G A 13: 23,011,605 W119* probably null Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Zfp820 A T 17: 21,823,872 M1K probably null Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 intron probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 intron probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTTGTGTTATTGTCATCCAGAGAAG -3'
(R):5'- TGGCTGAAATGGAAGCTCGG -3'

Sequencing Primer
(F):5'- TTGTCATCCAGAGAAGAGTTCG -3'
(R):5'- GCTCGGAAATGAGTCTGAATTG -3'
Posted On2016-02-04