Incidental Mutation 'R4807:Sycp2'
ID370732
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 042426-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4807 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 178393961 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134] [ENSMUST00000081134] [ENSMUST00000081134] [ENSMUST00000081134] [ENSMUST00000138175]
Predicted Effect probably benign
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138175
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspm T A 1: 139,477,919 F1515I probably damaging Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx24 A T 12: 103,419,461 F248L probably damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vmn1r213 G A 13: 23,011,605 W119* probably null Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Zfp820 A T 17: 21,823,872 M1K probably null Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAGTTTTCCTTCTAAATACAGAGCC -3'
(R):5'- CAGGTAGGCATTGTGGAAGC -3'

Sequencing Primer
(F):5'- CAAACAAAGCCATCAGGAGTATTTAG -3'
(R):5'- GCTTTGTGTAGAATGACCACAG -3'
Posted On2016-02-04