Incidental Mutation 'R0421:Ccr9'
ID37075
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission 038623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0421 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123779606 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 118 (M118L)
Ref Sequence ENSEMBL: ENSMUSP00000137144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: M106L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: M106L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: M118L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: M118L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: M118L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: M118L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Meta Mutation Damage Score 0.1090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,984 T131A probably damaging Het
Abi1 G A 2: 22,960,827 T195I probably damaging Het
Afap1l1 T C 18: 61,751,874 N180S probably damaging Het
Arsg A G 11: 109,527,766 Y196C probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atp2b2 C A 6: 113,813,888 R185L probably damaging Het
Cdh12 A T 15: 21,480,224 probably null Het
Cdk13 T C 13: 17,763,170 S763G probably damaging Het
Cenpk C A 13: 104,242,403 N177K probably benign Het
Cfap43 T G 19: 47,835,575 N119T probably benign Het
Chrna6 T C 8: 27,408,387 E101G probably null Het
Clasp2 G A 9: 113,854,302 R400H probably benign Het
Col6a6 T C 9: 105,784,206 M235V probably benign Het
Ddx49 A T 8: 70,295,632 L291Q probably damaging Het
Dhrs7 A T 12: 72,653,086 probably benign Het
Dnah5 A T 15: 28,229,541 K107M possibly damaging Het
Dsg2 C T 18: 20,579,391 R151C probably damaging Het
Dsn1 T C 2: 157,005,869 T2A possibly damaging Het
Edem3 A G 1: 151,792,438 probably benign Het
Eif3c T C 7: 126,563,712 N133S possibly damaging Het
F10 A G 8: 13,045,097 K85E probably benign Het
Fam129a T A 1: 151,709,082 probably benign Het
Fam57b G A 7: 126,825,015 V44M probably damaging Het
Fbn2 T A 18: 58,027,804 probably benign Het
Gtpbp10 A T 5: 5,557,290 H50Q probably benign Het
Hephl1 A G 9: 15,059,160 F1013L probably benign Het
Hps3 C A 3: 20,029,316 V238F probably benign Het
Kcna10 A C 3: 107,194,504 K150N probably damaging Het
Kirrel C T 3: 87,083,607 G636D probably damaging Het
Kndc1 G A 7: 139,908,996 R189H probably damaging Het
Knop1 C T 7: 118,855,629 E50K possibly damaging Het
Kpna7 T A 5: 144,989,741 H467L possibly damaging Het
Lcn4 T C 2: 26,668,649 N142D possibly damaging Het
Map3k3 T C 11: 106,148,915 probably benign Het
Mdn1 A G 4: 32,684,707 T806A probably benign Het
Nbeal1 T A 1: 60,268,439 N1703K probably benign Het
Neurl4 T C 11: 69,908,534 V914A probably damaging Het
Nop56 T C 2: 130,276,772 S275P possibly damaging Het
Olfr352 A G 2: 36,869,641 E25G possibly damaging Het
Olfr655 A G 7: 104,596,722 V153A probably benign Het
Olfr868 A G 9: 20,101,475 K239E probably damaging Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Pappa2 A T 1: 158,848,080 I1032N probably damaging Het
Pcdh7 A G 5: 57,720,060 E319G probably damaging Het
Pcdhb11 T A 18: 37,422,480 S288T probably benign Het
Phip A T 9: 82,926,457 D488E probably damaging Het
Pla2g7 A T 17: 43,611,412 H394L probably damaging Het
Plk3 A G 4: 117,133,444 V69A probably damaging Het
Prob1 C A 18: 35,653,030 A724S possibly damaging Het
Prune2 T C 19: 17,123,311 F2060L probably benign Het
Rgl3 G A 9: 21,976,032 R498C probably benign Het
Rnf213 A C 11: 119,447,257 N3362H probably damaging Het
Sbds A G 5: 130,253,933 probably benign Het
Scn9a T C 2: 66,543,277 S453G probably benign Het
Sh3rf3 T C 10: 58,984,075 L236P probably damaging Het
Skint1 A G 4: 112,019,014 N44S possibly damaging Het
Slc5a1 T A 5: 33,134,652 I141N probably damaging Het
Trank1 T A 9: 111,391,839 I2548N probably damaging Het
Tsc22d2 G A 3: 58,417,328 probably benign Het
Unc13c T A 9: 73,933,210 I120F possibly damaging Het
Vmn2r11 T G 5: 109,059,428 I9L probably benign Het
Vmn2r58 T G 7: 41,865,204 N114H probably benign Het
Vps53 A G 11: 76,082,670 L166P probably damaging Het
Zfp119a T A 17: 55,865,248 K532* probably null Het
Zfp472 A G 17: 32,975,923 T11A possibly damaging Het
Zfp512b T A 2: 181,588,258 K87* probably null Het
Zfp518b G A 5: 38,674,575 P29L probably damaging Het
Zfp599 A G 9: 22,250,547 probably benign Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
hamlet UTSW 9 123779439 missense probably damaging 1.00
Laertes UTSW 9 123779846 missense probably damaging 1.00
Ophelia UTSW 9 123779469 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
R8154:Ccr9 UTSW 9 123779831 missense probably benign 0.00
R8283:Ccr9 UTSW 9 123779631 missense probably damaging 1.00
R8525:Ccr9 UTSW 9 123779667 missense probably benign 0.31
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATTGTGGGCACCTTGGGCAAC -3'
(R):5'- TGGCAATACCAGATTCCCCACTGAC -3'

Sequencing Primer
(F):5'- AACAGCCTGGTCATCCTTG -3'
(R):5'- AGATTCCCCACTGACTTGACTG -3'
Posted On2013-05-09